[galaxy-commits] commit/galaxy-central: 3 new changesets

3 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/c99613c96a70/ changeset: c99613c96a70 user: fubar date: 2012-06-08 00:26:09 summary: Updates to fastqc tool to wrap the user supplied job name in quotes and sanitize to letters/digits only Some downstream problems from ( characters reported today but probably needs deeper sanitizing affected #: 1 file diff -r 37352829fedd8ef5df912281b91471302cd6e5dd -r c99613c96a707a57cbbbed8e0f9968dede6f518b tools/rgenetics/rgFastQC.xml --- a/tools/rgenetics/rgFastQC.xml +++ b/tools/rgenetics/rgFastQC.xml @@ -1,4 +1,4 @@ -<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.4"> +<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.5"><description>using FastQC from Babraham</description><command interpreter="python"> rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -j $input_file.name -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc @@ -11,7 +11,12 @@ </requirements><inputs><param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> - <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" /> + <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" + help="Letters and numbers only please - other characters will be removed"> + <sanitizer invalid_char=""> + <valid initial="string.letters,string.digits"/> + </sanitizer> + </param><param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/></inputs> https://bitbucket.org/galaxy/galaxy-central/changeset/fb28365f5daa/ changeset: fb28365f5daa user: fubar date: 2012-06-08 00:28:35 summary: Add some more missing quotes to command line. affected #: 1 file diff -r c99613c96a707a57cbbbed8e0f9968dede6f518b -r fb28365f5daa4cb74d3043b98a64c015bfbe4e12 tools/rgenetics/rgFastQC.xml --- a/tools/rgenetics/rgFastQC.xml +++ b/tools/rgenetics/rgFastQC.xml @@ -1,7 +1,7 @@ <tool name="Fastqc: Fastqc QC" id="fastqc" version="0.5"><description>using FastQC from Babraham</description><command interpreter="python"> - rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -j $input_file.name -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc + rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc" #if $contaminants.dataset and str($contaminants) > '' -c "$contaminants" #end if https://bitbucket.org/galaxy/galaxy-central/changeset/2a9c71e1d220/ changeset: 2a9c71e1d220 user: fubar date: 2012-06-08 00:31:56 summary: branch merge affected #: 1 file diff -r fb28365f5daa4cb74d3043b98a64c015bfbe4e12 -r 2a9c71e1d2209016559b09964c8b5a6f9854a5d5 static/scripts/viz/trackster.js --- a/static/scripts/viz/trackster.js +++ b/static/scripts/viz/trackster.js @@ -2794,12 +2794,11 @@ /** * Tiles drawn by tracks. */ -var Tile = function(track, index, resolution, canvas, data) { +var Tile = function(track, region, resolution, canvas, data) { this.track = track; - this.index = index; - var tile_bounds = this.track._get_tile_bounds(index, resolution); - this.low = tile_bounds[0]; - this.high = tile_bounds[1]; + this.region = region; + this.low = region.get('start'); + this.high = region.get('end'); this.resolution = resolution; // Wrap element in div for background and explicitly set height. Use canvas // height attribute because canvas may not have height if it is not in document yet. @@ -2813,15 +2812,15 @@ */ Tile.prototype.predisplay_actions = function() {}; -var SummaryTreeTile = function(track, index, resolution, canvas, data, max_val) { - Tile.call(this, track, index, resolution, canvas, data); +var SummaryTreeTile = function(track, region, resolution, canvas, data, max_val) { + Tile.call(this, track, region, resolution, canvas, data); this.max_val = max_val; }; extend(SummaryTreeTile.prototype, Tile.prototype); -var FeatureTrackTile = function(track, index, resolution, canvas, data, w_scale, mode, message, all_slotted, feature_mapper) { +var FeatureTrackTile = function(track, region, resolution, canvas, data, w_scale, mode, message, all_slotted, feature_mapper) { // Attribute init. - Tile.call(this, track, index, resolution, canvas, data); + Tile.call(this, track, region, resolution, canvas, data); this.mode = mode; this.all_slotted = all_slotted; this.feature_mapper = feature_mapper; @@ -3586,12 +3585,7 @@ draw_helper: function(force, width, tile_index, resolution, parent_element, w_scale, kwargs) { var track = this, key = this._gen_tile_cache_key(width, w_scale, tile_index), - tile_bounds = this._get_tile_bounds(tile_index, resolution), - region = new GenomeRegion({ - chrom: this.view.chrom, - start: tile_bounds[0], - end: tile_bounds[1] - }); + region = this._get_tile_bounds(tile_index, resolution); // Init kwargs if necessary to avoid having to check if kwargs defined. if (!kwargs) { kwargs = {}; } @@ -3646,7 +3640,7 @@ canvas.height = height; var ctx = canvas.getContext('2d'); ctx.translate(this.left_offset, 0); - var tile = track.draw_tile(tile_data, ctx, mode, resolution, tile_index, w_scale, seq_data); + var tile = track.draw_tile(tile_data, ctx, mode, resolution, region, w_scale, seq_data); // Don't cache, show if no tile. if (tile !== undefined) { @@ -3679,11 +3673,11 @@ * @param ctx canvas context to draw on * @param mode mode to draw in * @param resolution view resolution - * @param tile_index index of tile to be drawn + * @param region region to draw on tile * @param w_scale pixels per base * @param ref_seq reference sequence data */ - draw_tile: function(result, ctx, mode, resolution, tile_index, w_scale, ref_seq) { + draw_tile: function(result, ctx, mode, resolution, region, w_scale, ref_seq) { console.log("Warning: TiledTrack.draw_tile() not implemented."); }, /** @@ -3720,21 +3714,27 @@ track.after_show_tile(tile); }, + /** * Actions to be taken after showing tile. */ after_show_tile: function(tile) {}, + /** - * Returns tile bounds--tile low and tile high--based on a tile index. Return value is an array - * with values tile_low and tile_high. + * Returns a genome region that corresponds to a tile at a particular resolution */ _get_tile_bounds: function(tile_index, resolution) { var tile_low = Math.floor( tile_index * TILE_SIZE * resolution ), tile_length = Math.ceil( TILE_SIZE * resolution ), // Tile high cannot be larger than view.max_high, which the chromosome length. tile_high = (tile_low + tile_length <= this.view.max_high ? tile_low + tile_length : this.view.max_high); - return [tile_low, tile_high]; + return new GenomeRegion({ + chrom: this.view.chrom, + start: tile_low, + end: tile_high + }); }, + /** * Utility function that creates a label string describing the region and parameters of a track's tool. */ @@ -3930,8 +3930,8 @@ var track = this, key = this._gen_tile_cache_key(width, w_scale, tile_index), tile_bounds = this._get_tile_bounds(tile_index, resolution), - tile_low = tile_bounds[0], - tile_high = tile_bounds[1]; + tile_low = tile_bounds.get('start'), + tile_high = tile_bounds.get('end'); // Init kwargs if necessary to avoid having to check if kwargs defined. if (!kwargs) { kwargs = {}; } @@ -3980,8 +3980,8 @@ var canvas = track.view.canvas_manager.new_canvas(), tile_bounds = track._get_tile_bounds(tile_index, resolution), - tile_low = tile_bounds[0], - tile_high = tile_bounds[1], + tile_low = tile_bounds.get('start'), + tile_high = tile_bounds.get('end'), all_data_index = 0, width = Math.ceil( (tile_high - tile_low) * w_scale ) + this.left_offset, height = 0, @@ -4021,7 +4021,7 @@ track = this.drawables[i]; tile_data = all_data[ all_data_index ]; seq_data = all_data[ all_data_index + 1 ]; - tile = track.draw_tile(tile_data, ctx, track_modes[i], resolution, tile_index, w_scale, seq_data); + tile = track.draw_tile(tile_data, ctx, track_modes[i], resolution, tile_bounds, w_scale, seq_data); } // Don't cache, show if no tile. @@ -4148,7 +4148,7 @@ /** * Draw ReferenceTrack tile. */ - draw_tile: function(seq, ctx, mode, resolution, tile_index, w_scale) { + draw_tile: function(seq, ctx, mode, resolution, region, w_scale) { var track = this; if (w_scale > this.view.canvas_manager.char_width_px) { @@ -4165,7 +4165,7 @@ ctx.fillText(seq[c], c_start, 10); } this.show_contents(); - return new Tile(track, tile_index, resolution, canvas, seq); + return new Tile(track, region, resolution, canvas, seq); } this.hide_contents(); } @@ -4294,17 +4294,16 @@ /** * Draw LineTrack tile. */ - draw_tile: function(result, ctx, mode, resolution, tile_index, w_scale) { + draw_tile: function(result, ctx, mode, resolution, region, w_scale) { // Paint onto canvas. var canvas = ctx.canvas, - tile_bounds = this._get_tile_bounds(tile_index, resolution), - tile_low = tile_bounds[0], - tile_high = tile_bounds[1], + tile_low = region.get('start'), + tile_high = region.get('end'), painter = new painters.LinePainter(result.data, tile_low, tile_high, this.prefs, mode); painter.draw(ctx, canvas.width, canvas.height, w_scale); - return new Tile(this, tile_index, resolution, canvas, result.data); + return new Tile(this, region, resolution, canvas, result.data); }, /** * LineTrack data cannot currently be subsetted. @@ -4682,16 +4681,15 @@ * @param cxt canvas context to draw on * @param mode mode to draw in * @param resolution view resolution - * @param tile_index index of tile to be drawn + * @param region region to draw on tile * @param w_scale pixels per base * @param ref_seq reference sequence data */ - draw_tile: function(result, ctx, mode, resolution, tile_index, w_scale, ref_seq) { + draw_tile: function(result, ctx, mode, resolution, region, w_scale, ref_seq) { var track = this, canvas = ctx.canvas, - tile_bounds = this._get_tile_bounds(tile_index, resolution), - tile_low = tile_bounds[0], - tile_high = tile_bounds[1], + tile_low = region.get('start'), + tile_high = region.get('end'), min_height = 25, left_offset = this.left_offset; @@ -4761,7 +4759,7 @@ feature_mapper.translation = -left_offset; } - return new FeatureTrackTile(track, tile_index, resolution, canvas, result.data, w_scale, mode, result.message, all_slotted, feature_mapper); + return new FeatureTrackTile(track, region, resolution, canvas, result.data, w_scale, mode, result.message, all_slotted, feature_mapper); }, /** * Returns true if data is compatible with a given mode. Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.