commit/galaxy-central: 2 new changesets
2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/60f63d6d4cb7/ Changeset: 60f63d6d4cb7 User: jmchilton Date: 2014-08-06 15:41:38 Summary: Add annotated citations for MAF tools. Add macro file to centralize this and in help citation description as well. Affected #: 17 files diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/genebed_maf_to_fasta.xml --- a/tools/maf/genebed_maf_to_fasta.xml +++ b/tools/maf/genebed_maf_to_fasta.xml @@ -1,5 +1,8 @@ <tool id="GeneBed_Maf_Fasta2" name="Stitch Gene blocks" version="1.0.1"><description>given a set of coding exon intervals</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python"> #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} @@ -87,12 +90,7 @@ * stitches blocks together and resolves overlaps based on alignment score; * outputs alignments in FASTA format. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/interval2maf.xml --- a/tools/maf/interval2maf.xml +++ b/tools/maf/interval2maf.xml @@ -1,5 +1,8 @@ <tool id="Interval2Maf1" name="Extract MAF blocks" version="1.0.1"><description>given a set of genomic intervals</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python"> #if $maf_source_type.maf_source == "user" #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species #else #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species @@ -283,12 +286,7 @@ s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/interval2maf_pairwise.xml --- a/tools/maf/interval2maf_pairwise.xml +++ b/tools/maf/interval2maf_pairwise.xml @@ -1,5 +1,8 @@ <tool id="Interval2Maf_pairwise1" name="Extract Pairwise MAF blocks" version="1.0.1"><description>given a set of genomic intervals</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$mafType --interval_file=$input1 --output_file=$out_file1 --indexLocation=${GALAXY_DATA_INDEX_DIR}/maf_pairwise.loc</command><inputs><param name="input1" type="data" format="interval" label="Interval File"> @@ -39,12 +42,7 @@ .. image:: ${static_path}/images/maf_icons/interval2maf.png ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/interval_maf_to_merged_fasta.xml --- a/tools/maf/interval_maf_to_merged_fasta.xml +++ b/tools/maf/interval_maf_to_merged_fasta.xml @@ -1,5 +1,8 @@ <tool id="Interval_Maf_Merged_Fasta2" name="Stitch MAF blocks" version="1.0.1"><description>given a set of genomic intervals</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python"> #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} @@ -103,12 +106,7 @@ .. image:: ${static_path}/images/maf_icons/stitchMaf.png ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/macros.xml --- /dev/null +++ b/tools/maf/macros.xml @@ -0,0 +1,16 @@ +<macros> + <token name="@HELP_CITATIONS@"> +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + + </token> + <xml name="citations"> + <citations> + <citation type="doi">10.1093/bioinformatics/btr398</citation> + </citations> + </xml> +</macros> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_by_block_number.xml --- a/tools/maf/maf_by_block_number.xml +++ b/tools/maf/maf_by_block_number.xml @@ -1,5 +1,8 @@ <tool id="maf_by_block_number1" name="Extract MAF by block number" version="1.0.1"><description>given a set of block numbers and a MAF file</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_by_block_number.py $input1 $input2 $out_file1 $block_col $species</command><inputs><param format="txt" name="input1" type="data" label="Block Numbers"/> @@ -29,12 +32,7 @@ This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_filter.xml --- a/tools/maf/maf_filter.xml +++ b/tools/maf/maf_filter.xml @@ -1,5 +1,8 @@ <tool id="MAF_filter" name="Filter MAF" version="1.0.1"><description>by specified attributes</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_filter.py $maf_filter_file $input1 $out_file1 $out_file1.files_path $species $min_size $max_size $min_species_per_block $exclude_incomplete_blocks ${input1.metadata.species}</command><inputs><page> @@ -191,12 +194,7 @@ You can also provide a size range and limit your output to the MAF blocks which fall within the specified range. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - -</help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_limit_size.xml --- a/tools/maf/maf_limit_size.xml +++ b/tools/maf/maf_limit_size.xml @@ -1,5 +1,8 @@ <tool id="maf_limit_size1" name="Filter MAF blocks" version="1.0.1"><description>by Size</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_limit_size.py $input1 $out_file1 $min_size $max_size</command><inputs><page> @@ -25,12 +28,7 @@ This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_limit_to_species.xml --- a/tools/maf/maf_limit_to_species.xml +++ b/tools/maf/maf_limit_to_species.xml @@ -1,5 +1,8 @@ <tool id="MAF_Limit_To_Species1" name="Filter MAF blocks"><description>by Species</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_limit_to_species.py $species $input1 $out_file1 $allow_partial $min_species</command><inputs><param name="input1" type="data" format="maf" label="MAF file"/> @@ -39,13 +42,8 @@ * **Exclude blocks with have only one species** - if this option is set to **YES** all single sequence alignment blocks WILL NOT be returned. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_reverse_complement.xml --- a/tools/maf/maf_reverse_complement.xml +++ b/tools/maf/maf_reverse_complement.xml @@ -1,5 +1,8 @@ <tool id="MAF_Reverse_Complement_1" name="Reverse Complement" version="1.0.1"><description>a MAF file</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_reverse_complement.py $input1 $out_file1 $species</command><inputs><page> @@ -42,12 +45,7 @@ s panTro1.chr6 31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT s mm5.chr6 120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_split_by_species.xml --- a/tools/maf/maf_split_by_species.xml +++ b/tools/maf/maf_split_by_species.xml @@ -1,5 +1,8 @@ <tool id="MAF_split_blocks_by_species1" name="Split MAF blocks" version="1.0.0"><description>by Species</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_split_by_species.py $input1 $out_file1 $collapse_columns</command><inputs><param format="maf" name="input1" type="data" label="MAF file to split"/> @@ -211,13 +214,8 @@ - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - +@HELP_CITATIONS@ </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_stats.xml --- a/tools/maf/maf_stats.xml +++ b/tools/maf/maf_stats.xml @@ -1,5 +1,8 @@ <tool id="maf_stats1" name="MAF Coverage Stats" version="1.0.1"><description>Alignment coverage information</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python"> maf_stats.py #if $maf_source_type.maf_source == "user": @@ -109,12 +112,7 @@ where **coverage** is the number of nucleotides divided by the total length of the provided intervals. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_thread_for_species.xml --- a/tools/maf/maf_thread_for_species.xml +++ b/tools/maf/maf_thread_for_species.xml @@ -1,5 +1,8 @@ <tool id="MAF_Thread_For_Species1" name="Join MAF blocks"><description>by Species</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_thread_for_species.py $input1 $out_file1 $species</command><inputs><param format="maf" name="input1" type="data" label="MAF file"/> @@ -48,13 +51,9 @@ s hg17.chr7 127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG ------- +@HELP_CITATIONS@ + </help> + <expand macro="citations" /> -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_to_bed.xml --- a/tools/maf/maf_to_bed.xml +++ b/tools/maf/maf_to_bed.xml @@ -1,5 +1,8 @@ <tool id="MAF_To_BED1" name="MAF to BED" force_history_refresh="True"><description>Converts a MAF formatted file to the BED format</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_to_bed.py "${ input1 }" "${ out_file1 }" "${ species }" "${ complete_blocks }" "." "${ out_file1.id }"</command><inputs><param format="maf" name="input1" type="data" label="MAF file to convert"/> @@ -123,14 +126,9 @@ 5. score - A score between 0 and 1000. 6. strand - Defines the strand - either '+' or '-'. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - +@HELP_CITATIONS@ </help> + <expand macro="citations" /><code file="maf_to_bed_code.py"/></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_to_fasta.xml --- a/tools/maf/maf_to_fasta.xml +++ b/tools/maf/maf_to_fasta.xml @@ -1,5 +1,8 @@ <tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1"><description>Converts a MAF formatted file to FASTA format</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python"> #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 @@ -188,12 +191,7 @@ - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - </help> +@HELP_CITATIONS@ + </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/maf_to_interval.xml --- a/tools/maf/maf_to_interval.xml +++ b/tools/maf/maf_to_interval.xml @@ -1,5 +1,8 @@ <tool id="MAF_To_Interval1" name="MAF to Interval" force_history_refresh="True"><description>Converts a MAF formatted file to the Interval format</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">maf_to_interval.py "${ input1 }" "${ out_file1 }" "${ out_file1.id }" "." "${ input1.dbkey }" "${ species }" "${ input1.metadata.species }" "${ complete_blocks }" "${ remove_gaps }"</command><inputs><param format="maf" name="input1" type="data" label="MAF file to convert"/> @@ -121,13 +124,8 @@ - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - +@HELP_CITATIONS@ </help> + <expand macro="citations" /></tool> diff -r 853b09d9ed468ea36b57f6ccb009d9134a403889 -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 tools/maf/vcf_to_maf_customtrack.xml --- a/tools/maf/vcf_to_maf_customtrack.xml +++ b/tools/maf/vcf_to_maf_customtrack.xml @@ -1,5 +1,8 @@ <tool id="vcf_to_maf_customtrack1" name="VCF to MAF Custom Track"><description>for display at UCSC</description> + <macros> + <import>macros.xml</import> + </macros><command interpreter="python">vcf_to_maf_customtrack.py '$out_file1' #if $vcf_source_type.vcf_file '${vcf_source_type.vcf_file[0].vcf_input.dbkey}' @@ -121,12 +124,8 @@ s CHB+JPT_1.5 0 1 + 1 *------ s CHB+JPT_2.5 0 7 + 7 *GGA*** ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - +@HELP_CITATIONS@ </help> + <expand macro="citations" /></tool> https://bitbucket.org/galaxy/galaxy-central/commits/39c983151fe3/ Changeset: 39c983151fe3 User: jmchilton Date: 2014-08-06 15:41:38 Summary: Add annotated citations various tools. Affected #: 9 files diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/beam.xml --- a/tools/phenotype_association/beam.xml +++ b/tools/phenotype_association/beam.xml @@ -134,4 +134,8 @@ Submitted. </help> + <citations> + <citation type="doi">10.1038/ng2110</citation> + <citation type="doi">10.1214/11-AOAS469</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/gpass.xml --- a/tools/phenotype_association/gpass.xml +++ b/tools/phenotype_association/gpass.xml @@ -109,4 +109,7 @@ Submitted. </help> + <citations> + <citation type="doi">10.1198/jasa.2011.ap10657</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/ldtools.xml --- a/tools/phenotype_association/ldtools.xml +++ b/tools/phenotype_association/ldtools.xml @@ -108,4 +108,7 @@ Am J Hum Genet. 74(1):106-20. Epub 2003 Dec 15. </help> + <citations> + <citation type="doi">10.1086/381000</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/linkToDavid.xml --- a/tools/phenotype_association/linkToDavid.xml +++ b/tools/phenotype_association/linkToDavid.xml @@ -107,4 +107,8 @@ Genome Biol. 4(5):P3. Epub 2003 Apr 3. </help> + <citations> + <citation type="doi">10.1038/nprot.2008.211</citation> + <citation type="doi">10.1186/gb-2003-4-5-p3</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/linkToGProfile.xml --- a/tools/phenotype_association/linkToGProfile.xml +++ b/tools/phenotype_association/linkToGProfile.xml @@ -87,4 +87,7 @@ Nucleic Acids Res. 35(Web Server issue):W193-200. Epub 2007 May 3. </help> + <citations> + <citation type="doi">10.1093/nar/gkm226</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/lps.xml --- a/tools/phenotype_association/lps.xml +++ b/tools/phenotype_association/lps.xml @@ -301,4 +301,18 @@ --></help> + <citations> + <citation type="bibtex">@ARTICLE{Kim07aninterior-point, + author = {Seung-jean Kim and Kwangmoo Koh and Michael Lustig and Stephen Boyd and Dimitry Gorinevsky}, + title = {An interior-point method for large-scale l1-regularized logistic regression}, + journal = {Journal of Machine Learning Research}, + year = {2007}, + volume = {2007} +}</citation> + <citation type="bibtex">@MISC{Shi08lasso-patternsearchalgorithm, + author = {Weiliang Shi and Grace Wahba and Stephen Wright and Kristine Lee and Ronald Klein and Barbara Klein}, + title = { LASSO-Patternsearch Algorithm with Application to Ophthalmology and Genomic Data}, + year = {2008} +}</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/pass.xml --- a/tools/phenotype_association/pass.xml +++ b/tools/phenotype_association/pass.xml @@ -123,4 +123,8 @@ Submitted. </help> + <citations> + <citation type="doi">10.1093/bioinformatics/btn549</citation> + <citation type="doi">10.1093/bioinformatics/btq379</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/phenotype_association/sift.xml --- a/tools/phenotype_association/sift.xml +++ b/tools/phenotype_association/sift.xml @@ -171,4 +171,10 @@ Nat Protoc. 4(7):1073-81. Epub 2009 Jun 25. </help> + <citations> + <citation type="doi">10.1101/gr.176601</citation> + <citation type="doi">10.1101/gr.212802</citation> + <citation type="doi">10.1093/nar/gkg509</citation> + <citation type="doi">10.1038/nprot.2009.86</citation> + </citations></tool> diff -r 60f63d6d4cb7b73286f3c747e8acaa475e4b6fa8 -r 39c983151fe328ff5d415f6da81ce5b21a7e18a4 tools/plotting/boxplot.xml --- a/tools/plotting/boxplot.xml +++ b/tools/plotting/boxplot.xml @@ -105,4 +105,7 @@ </help> + <citations> + <citation type="doi">10.1093/bioinformatics/btq281</citation> + </citations></tool> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.
participants (1)
-
commits-noreply＠bitbucket.org