3 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/67e2f1881067/ changeset: r5572:67e2f1881067 user: fubar date: 2011-05-17 16:29:06 summary: amerkinized spelin' and removed copyright notices on some picard tool forms affected #: 7 files (3.3 KB) --- a/tools/picard/rgPicardASMetrics.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardASMetrics.xml Tue May 17 10:29:06 2011 -0400 @@ -183,24 +183,6 @@ Picard and Samtools go together. They are external to and completely independent of Galaxy. We acknowledge that all credit for their methods and contribution are due to them. -Here, you can apply Picard tools through Galaxy which you may find much easier than through the native Picard command line interface. - - - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 - -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> --- a/tools/picard/rgPicardFixMate.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardFixMate.xml Tue May 17 10:29:06 2011 -0400 @@ -101,7 +101,7 @@ if a tool fails unexpectedly when you run it in Galaxy. All the Picard tools are freely available and are documented -at http://picard.sourceforge.net/command-line-overview.shtml#CollectAlignmentSu... +at http://picard.sourceforge.net/command-line-overview.shtml Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 Code cleaned up and the ugliest hacks repaired by Raphael Lullis. @@ -109,18 +109,6 @@ It takes a village of programmers to wrap a picard tool ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> --- a/tools/picard/rgPicardGCBiasMetrics.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardGCBiasMetrics.xml Tue May 17 10:29:06 2011 -0400 @@ -162,22 +162,5 @@ They are external to and completely independent of Galaxy. We acknowledge that all credit for their methods and contribution are due to them. -Here, you can apply Picard tools through Galaxy which might be easier than through the native Picard command line interface. - - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> --- a/tools/picard/rgPicardHsMetrics.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardHsMetrics.xml Tue May 17 10:29:06 2011 -0400 @@ -1,5 +1,5 @@ <tool name="Sam/bam Hybrid Selection Metrics:" id="PicardHsMetrics" version="0.01"> - <description>For (eg exome) targetted data</description> + <description>For (eg exome) targeted data</description><command interpreter="python"> picard_wrapper.py -i "$input_file" -d "$html_file.files_path" -t "$html_file" --datatype "$input_file.ext" @@ -139,19 +139,6 @@ aligned short read sequence data. Sequence data must be chosen from the sam/bam format files in your current history. Target and bait files must be selected from the UCSC BED format in your current history. ------ - -.. class:: infomark - -**Copyright** - -This is part of the rgenetics toolkit. - -Written by Ross Lazarus 2010 -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> --- a/tools/picard/rgPicardInsertSize.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardInsertSize.xml Tue May 17 10:29:06 2011 -0400 @@ -78,23 +78,8 @@ if a tool fails unexpectedly when you run it in Galaxy. All the Picard tools are freely available and are documented -at http://picard.sourceforge.net/command-line-overview.shtml#CollectInsertSizeM... +at http://picard.sourceforge.net/command-line-overview.shtml -Here, you can apply Picard tools through Galaxy which might be easier than through the native Picard command line interface. - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -Code cleaned up and the ugliest hacks repaired by Raphael Lullis - -All rgenetics artifacts are available licensed under the LGPL -Other dependencies are licensed at the author's discretion - please see each individual package for details </help></tool> --- a/tools/picard/rgPicardLibComplexity.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardLibComplexity.xml Tue May 17 10:29:06 2011 -0400 @@ -121,22 +121,6 @@ All the Picard tools are freely available and are documented at http://picard.sourceforge.net/command-line-overview.shtml#CollectInsertSizeM... ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -Code cleaned up and the ugliest hacks repaired by Raphael Lullis - -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> --- a/tools/picard/rgPicardMarkDups.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardMarkDups.xml Tue May 17 10:29:06 2011 -0400 @@ -120,24 +120,6 @@ All the Picard tools are freely available and are documented at http://picard.sourceforge.net/command-line-overview.shtml#CollectInsertSizeM... -Here, you can apply Picard tools through Galaxy which might be easier than through the native Picard command line interface. - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -Code cleaned up and the ugliest hacks repaired by Raphael Lullis - -All rgenetics artifacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - -.. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> http://bitbucket.org/galaxy/galaxy-central/changeset/d6a905426210/ changeset: r5573:d6a905426210 user: fubar date: 2011-05-17 17:39:52 summary: branch merge affected #: 2 files (331 bytes) --- a/tools/ngs_rna/cufflinks_wrapper.py Tue May 17 10:29:06 2011 -0400 +++ b/tools/ngs_rna/cufflinks_wrapper.py Tue May 17 11:39:52 2011 -0400 @@ -34,9 +34,12 @@ where each end is 50bp, you should set -r to be 200. The default is 45bp.') parser.add_option( '-G', '--GTF', dest='GTF', help='Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.' ) - # Normalization options. + # Normalization options. parser.add_option( "-N", "--quartile-normalization", dest="do_normalization", action="store_true" ) + # Wrapper / Galaxy options. + parser.add_option( '-A', '--assembled-isoforms-output', dest='assembled_isoforms_output_file', help='Assembled isoforms output file; formate is GTF.' ) + # Advanced Options: parser.add_option( '--num-importance-samples', dest='num_importance_samples', help='Sets the number of importance samples generated for each locus during abundance estimation. Default: 1000' ) parser.add_option( '--max-mle-iterations', dest='max_mle_iterations', help='Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000' ) @@ -136,6 +139,9 @@ except OverflowError: pass tmp_stderr.close() + + # Copy outputs. + shutil.copyfile( "transcripts.gtf" , options.assembled_isoforms_output_file ) # Error checking. if returncode != 0: --- a/tools/ngs_rna/cufflinks_wrapper.xml Tue May 17 10:29:06 2011 -0400 +++ b/tools/ngs_rna/cufflinks_wrapper.xml Tue May 17 11:39:52 2011 -0400 @@ -6,6 +6,7 @@ <command interpreter="python"> cufflinks_wrapper.py --input=$input + --assembled-isoforms-output=$assembled_isoforms --num-threads="4" -I $max_intron_len -F $min_isoform_fraction @@ -95,7 +96,7 @@ <outputs><data format="tabular" name="genes_expression" label="${tool.name} on ${on_string}: gene expression" from_work_dir="genes.fpkm_tracking"/><data format="tabular" name="transcripts_expression" label="${tool.name} on ${on_string}: transcript expression" from_work_dir="isoforms.fpkm_tracking"/> - <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts" from_work_dir="transcripts.gtf"/> + <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts"/></outputs><tests> http://bitbucket.org/galaxy/galaxy-central/changeset/56b4c606cfd5/ changeset: r5574:56b4c606cfd5 user: fubar date: 2011-05-17 18:14:32 summary: branch merge with Kelly's fixes affected #: 5 files (16.5 KB) --- a/tools/maf/genebed_maf_to_fasta.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/genebed_maf_to_fasta.xml Tue May 17 12:14:32 2011 -0400 @@ -8,6 +8,7 @@ <inputs><param name="input1" type="data" format="bed" label="Gene BED File"><validator type="unspecified_build" /> + <validator type="expression" message="Input must be in BED12 format.">value.metadata.columns >= 12</validator><!-- allow 12+ columns, not as strict as possible. TODO: only list bed files with 12+ columns --></param><conditional name="maf_source_type"><param name="maf_source" type="select" label="MAF Source"> --- a/tools/maf/interval2maf.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/interval2maf.xml Tue May 17 12:14:32 2011 -0400 @@ -55,7 +55,7 @@ </when></conditional><conditional name="split_blocks_by_species_selector"> - <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="See the Split MAF blocks by Species tool for more information."> + <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="Not usually applicable. See help below for more information."><option value="split_blocks_by_species">Split by species</option><option value="dont_split_blocks_by_species" selected="true">Do not split</option></param> @@ -112,5 +112,176 @@ .. image:: ./static/images/maf_icons/interval2maf.png +------- + +**Split blocks by species** + +This option examines each MAF block for multiple occurrences of a species in a single block. When this occurs, a block is split into multiple blocks where every combination of one sequence per species per block is represented. + +The interface for this option has two inputs: + + * **MAF file to split**. Choose multiple alignments from history to be split by species. + * **Collapse empty alignment columns**. Should alignment columns containing only gaps in the new blocks be removed. + + + +**Example 1**: **Collapse empty alignment columns is Yes**: + +For the following alignment:: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + +the tool will create **a single** history item containing 12 alignment blocks (notice that no columns contain only gaps):: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT-GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC--GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC-GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGCAG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC---AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC---AG + + + +**Example 2**: **Collapse empty alignment columns is No**: + +For the following alignment:: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + +the tool will create **a single** history item containing 12 alignment blocks (notice that some columns contain only gaps):: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + </help></tool> --- a/tools/maf/maf_to_bed.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/maf_to_bed.xml Tue May 17 12:14:32 2011 -0400 @@ -1,5 +1,5 @@ <tool id="MAF_To_BED1" name="Maf to BED" force_history_refresh="True"> - <description>Converts a MAF formated file to the BED format</description> + <description>Converts a MAF formatted file to the BED format</description><command interpreter="python">maf_to_bed.py $input1 $out_file1 $species $complete_blocks $__new_file_path__</command><inputs><param format="maf" name="input1" type="data" label="MAF file to convert"/> --- a/tools/maf/maf_to_fasta.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/maf_to_fasta.xml Tue May 17 12:14:32 2011 -0400 @@ -1,5 +1,5 @@ <tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1"> - <description>Converts a MAF formated file to FASTA format</description> + <description>Converts a MAF formatted file to FASTA format</description><command interpreter="python"> #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 --- a/tools/ngs_rna/tophat_wrapper.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/ngs_rna/tophat_wrapper.xml Tue May 17 12:14:32 2011 -0400 @@ -1,4 +1,4 @@ -<tool id="tophat" name="Tophat" version="1.2.0"> +<tool id="tophat" name="Tophat" version="1.2.1"><description>Find splice junctions using RNA-seq data</description><requirements><requirement type="package">tophat</requirement> @@ -100,7 +100,7 @@ --seg-length=$singlePaired.pParams.seg_length --library-type=$singlePaired.pParams.library_type - ## Indel search. + ## Indel search. #if $singlePaired.pParams.indel_search.allow_indel_search == "Yes": --allow-indels --max-insertion-length $singlePaired.pParams.indel_search.max_insertion_length @@ -386,6 +386,23 @@ ( singlePaired['pParams']['indel_search']['allow_indel_search'] == 'Yes' ) ) ) </filter> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions></data><data format="bed" name="deletions" label="${tool.name} on ${on_string}: deletions" from_work_dir="tophat_out/deletions.bed"><filter> @@ -396,9 +413,62 @@ ( singlePaired['pParams']['indel_search']['allow_indel_search'] == 'Yes' ) ) ) </filter> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions></data> - <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"/> - <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"/> + <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </data></outputs><tests> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.