commit/galaxy-central: 2 new changesets

7 Dec 2012

2 new commits in galaxy-central:


https://bitbucket.org/galaxy/galaxy-central/changeset/659392eae2a8/
changeset:   659392eae2a8
user:        inithello
date:        2012-12-07 22:38:26
summary:     Revert tool migration.
affected #:  35 files

diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 lib/galaxy/tool_shed/migrate/versions/0008_tools.py

--- a/lib/galaxy/tool_shed/migrate/versions/0008_tools.py
+++ /dev/null
@@ -1,21 +0,0 @@
-"""
-The following tools have been eliminated from the distribution:
-Add column to an existing dataset, Change Case of selected columns, 
-Condense consecutive characters, Convert delimiters to TAB, 
-Cut columns from a table, Merge Columns together, Remove beginning of a file, 
-Select first lines from a dataset, Select last lines from a dataset, 
-and Trim leading or trailing characters.  The tools are now available in the 
-repositories named add_value, change_case, condense_characters, 
-convert_characters, cut_columns, merge_cols, remove_beginning, 
-show_beginning, show_tail, and trimmer from the main Galaxy tool shed at 
-http://toolshed.g2.bx.psu.edu, and will be installed into your 
-local Galaxy instance at the location discussed above by running 
-the following command.
-"""
-
-import sys
-
-def upgrade():
-    print __doc__
-def downgrade():
-    pass


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 scripts/migrate_tools/0008_tools.sh
--- a/scripts/migrate_tools/0008_tools.sh
+++ /dev/null
@@ -1,4 +0,0 @@
-#!/bin/sh
-
-cd `dirname $0`/../..
-python ./scripts/migrate_tools/migrate_tools.py 0008_tools.xml $@


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 scripts/migrate_tools/0008_tools.xml
--- a/scripts/migrate_tools/0008_tools.xml
+++ /dev/null
@@ -1,33 +0,0 @@
-<?xml version="1.0"?>
-<toolshed name="toolshed.g2.bx.psu.edu">
-    <repository name="add_value" description="Add a value as a new column." changeset_revision="181dd378275c">
-        <tool id="addValue" version="1.0.0" file="fixedValueColumn.xml" />
-    </repository>
-    <repository name="change_case" description="Change the case of a column." changeset_revision="e6f966602870">
-        <tool id="ChangeCase" version="1.0.0" file="changeCase.xml" />
-    </repository>
-    <repository name="condense_characters" description="Condense repeated characters." changeset_revision="2c08781560de">
-        <tool id="Condense characters1" version="1.0.0" file="condense_characters.xml" />
-    </repository>
-    <repository name="convert_characters" description="Convert delimiters to TAB." changeset_revision="64d46676a13e">
-        <tool id="Convert characters1" version="1.0.0" file="convert_characters.xml" />
-    </repository>
-    <repository name="cut_columns" description="Remove or rearrange columns." changeset_revision="34c29e183ef7">
-        <tool id="Cut1" version="1.0.1" file="cutWrapper.xml" />
-    </repository>
-    <repository name="merge_cols" description="Merge columns together." changeset_revision="28ca7552e884">
-        <tool id="mergeCols1" version="1.0.1" file="mergeCols.xml" />
-    </repository>
-    <repository name="remove_beginning" description="Remove lines from the beginning of a file." changeset_revision="d9b82504a321">
-        <tool id="Remove beginning1" version="1.0.0" file="remove_beginning.xml" />
-    </repository>
-    <repository name="show_beginning" description="Select lines from the beginning of a file." changeset_revision="ecca14446e6a">
-        <tool id="Show beginning1" version="1.0.0" file="headWrapper.xml" />
-    </repository>
-    <repository name="show_tail" description="Select lines from the end of a file." changeset_revision="8bb4d908a523">
-        <tool id="Show tail1" version="1.0.0" file="tailWrapper.xml" />
-    </repository>
-    <repository name="trimmer" description="Trim trailing characters from each line or column." changeset_revision="f862a6e4d096">
-        <tool id="trimmer" version="0.0.1" file="trimmer.xml" />
-    </repository>
-</toolshed>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/a.txt
--- /dev/null
+++ b/test-data/a.txt
@@ -0,0 +1,15 @@
+ CHR        SNP         BP   A1       TEST    NMISS       BETA         STAT            P 
+   1  rs1181876    3671541    T     DOMDEV      958     -1.415       -3.326    0.0009161
+   1 rs10492923    5092886    C        ADD     1007      5.105        4.368    1.382e-05
+   1 rs10492923    5092886    C     DOMDEV     1007     -5.612       -4.249     2.35e-05
+   1 rs10492923    5092886    C   GENO_2DF     1007         NA         19.9    4.775e-05
+   1  rs1801133   11778965    T        ADD     1022       1.23         3.97    7.682e-05
+   1  rs1801133   11778965    T   GENO_2DF     1022         NA        16.07    0.0003233
+   1  rs1361912   12663121    A        ADD     1021      12.69        4.093    4.596e-05
+   1  rs1361912   12663121    A     DOMDEV     1021     -12.37       -3.945    8.533e-05
+   1  rs1361912   12663121    A   GENO_2DF     1021         NA        17.05    0.0001982
+   1  rs1009806   19373138    G        ADD     1021     -1.334       -3.756    0.0001826
+   1  rs1009806   19373138    G   GENO_2DF     1021         NA        19.36    6.244e-05
+   1   rs873654   29550948    A     DOMDEV     1012      1.526          3.6    0.0003339
+   1 rs10489527   36800027    C        ADD     1016      12.67        4.114    4.211e-05
+   1 rs10489527   36800027    C     DOMDEV     1016     -13.05        -4.02    6.249e-05
\ No newline at end of file


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/changeCase_out1.tabular
--- /dev/null
+++ b/test-data/changeCase_out1.tabular
@@ -0,0 +1,10 @@
+CHR1	4225	19670
+CHR10	6	8
+CHR1	24417	24420
+CHR6_HLA_HAP2	0	150
+CHR2	1	5
+CHR10	2	10
+CHR1	30	55
+CHRY	1	20
+CHR1	1225979	42287290
+CHR10	7	8


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/changeCase_out2.tabular
--- /dev/null
+++ b/test-data/changeCase_out2.tabular
@@ -0,0 +1,65 @@
+CHR1	147962192	147962580	CCDS989.1_cds_0_0_chr1_147962193_r	0	-
+CHR1	147984545	147984630	CCDS990.1_cds_0_0_chr1_147984546_f	0	+
+CHR1	148078400	148078582	CCDS993.1_cds_0_0_chr1_148078401_r	0	-
+CHR1	148185136	148185276	CCDS996.1_cds_0_0_chr1_148185137_f	0	+
+CHR10	55251623	55253124	CCDS7248.1_cds_0_0_chr10_55251624_r	0	-
+CHR11	116124407	116124501	CCDS8374.1_cds_0_0_chr11_116124408_r	0	-
+CHR11	116206508	116206563	CCDS8377.1_cds_0_0_chr11_116206509_f	0	+
+CHR11	116211733	116212337	CCDS8378.1_cds_0_0_chr11_116211734_r	0	-
+CHR11	1812377	1812407	CCDS7726.1_cds_0_0_chr11_1812378_f	0	+
+CHR12	38440094	38440321	CCDS8736.1_cds_0_0_chr12_38440095_r	0	-
+CHR13	112381694	112381953	CCDS9526.1_cds_0_0_chr13_112381695_f	0	+
+CHR14	98710240	98712285	CCDS9949.1_cds_0_0_chr14_98710241_r	0	-
+CHR15	41486872	41487060	CCDS10096.1_cds_0_0_chr15_41486873_r	0	-
+CHR15	41673708	41673857	CCDS10097.1_cds_0_0_chr15_41673709_f	0	+
+CHR15	41679161	41679250	CCDS10098.1_cds_0_0_chr15_41679162_r	0	-
+CHR15	41826029	41826196	CCDS10101.1_cds_0_0_chr15_41826030_f	0	+
+CHR16	142908	143003	CCDS10397.1_cds_0_0_chr16_142909_f	0	+
+CHR16	179963	180135	CCDS10401.1_cds_0_0_chr16_179964_r	0	-
+CHR16	244413	244681	CCDS10402.1_cds_0_0_chr16_244414_f	0	+
+CHR16	259268	259383	CCDS10403.1_cds_0_0_chr16_259269_r	0	-
+CHR18	23786114	23786321	CCDS11891.1_cds_0_0_chr18_23786115_r	0	-
+CHR18	59406881	59407046	CCDS11985.1_cds_0_0_chr18_59406882_f	0	+
+CHR18	59455932	59456337	CCDS11986.1_cds_0_0_chr18_59455933_r	0	-
+CHR18	59600586	59600754	CCDS11988.1_cds_0_0_chr18_59600587_f	0	+
+CHR19	59068595	59069564	CCDS12866.1_cds_0_0_chr19_59068596_f	0	+
+CHR19	59236026	59236146	CCDS12872.1_cds_0_0_chr19_59236027_r	0	-
+CHR19	59297998	59298008	CCDS12877.1_cds_0_0_chr19_59297999_f	0	+
+CHR19	59302168	59302288	CCDS12878.1_cds_0_0_chr19_59302169_r	0	-
+CHR2	118288583	118288668	CCDS2120.1_cds_0_0_chr2_118288584_f	0	+
+CHR2	118394148	118394202	CCDS2121.1_cds_0_0_chr2_118394149_r	0	-
+CHR2	220190202	220190242	CCDS2441.1_cds_0_0_chr2_220190203_f	0	+
+CHR2	220229609	220230869	CCDS2443.1_cds_0_0_chr2_220229610_r	0	-
+CHR20	33330413	33330423	CCDS13249.1_cds_0_0_chr20_33330414_r	0	-
+CHR20	33513606	33513792	CCDS13255.1_cds_0_0_chr20_33513607_f	0	+
+CHR20	33579500	33579527	CCDS13256.1_cds_0_0_chr20_33579501_r	0	-
+CHR20	33593260	33593348	CCDS13257.1_cds_0_0_chr20_33593261_f	0	+
+CHR21	32707032	32707192	CCDS13614.1_cds_0_0_chr21_32707033_f	0	+
+CHR21	32869641	32870022	CCDS13615.1_cds_0_0_chr21_32869642_r	0	-
+CHR21	33321040	33322012	CCDS13620.1_cds_0_0_chr21_33321041_f	0	+
+CHR21	33744994	33745040	CCDS13625.1_cds_0_0_chr21_33744995_r	0	-
+CHR22	30120223	30120265	CCDS13897.1_cds_0_0_chr22_30120224_f	0	+
+CHR22	30160419	30160661	CCDS13898.1_cds_0_0_chr22_30160420_r	0	-
+CHR22	30665273	30665360	CCDS13901.1_cds_0_0_chr22_30665274_f	0	+
+CHR22	30939054	30939266	CCDS13903.1_cds_0_0_chr22_30939055_r	0	-
+CHR5	131424298	131424460	CCDS4149.1_cds_0_0_chr5_131424299_f	0	+
+CHR5	131556601	131556672	CCDS4151.1_cds_0_0_chr5_131556602_r	0	-
+CHR5	131621326	131621419	CCDS4152.1_cds_0_0_chr5_131621327_f	0	+
+CHR5	131847541	131847666	CCDS4155.1_cds_0_0_chr5_131847542_r	0	-
+CHR6	108299600	108299744	CCDS5061.1_cds_0_0_chr6_108299601_r	0	-
+CHR6	108594662	108594687	CCDS5063.1_cds_0_0_chr6_108594663_f	0	+
+CHR6	108640045	108640151	CCDS5064.1_cds_0_0_chr6_108640046_r	0	-
+CHR6	108722976	108723115	CCDS5067.1_cds_0_0_chr6_108722977_f	0	+
+CHR7	113660517	113660685	CCDS5760.1_cds_0_0_chr7_113660518_f	0	+
+CHR7	116512159	116512389	CCDS5771.1_cds_0_0_chr7_116512160_r	0	-
+CHR7	116714099	116714152	CCDS5773.1_cds_0_0_chr7_116714100_f	0	+
+CHR7	116945541	116945787	CCDS5774.1_cds_0_0_chr7_116945542_r	0	-
+CHR8	118881131	118881317	CCDS6324.1_cds_0_0_chr8_118881132_r	0	-
+CHR9	128764156	128764189	CCDS6914.1_cds_0_0_chr9_128764157_f	0	+
+CHR9	128787519	128789136	CCDS6915.1_cds_0_0_chr9_128787520_r	0	-
+CHR9	128882427	128882523	CCDS6917.1_cds_0_0_chr9_128882428_f	0	+
+CHR9	128937229	128937445	CCDS6919.1_cds_0_0_chr9_128937230_r	0	-
+CHRX	122745047	122745924	CCDS14606.1_cds_0_0_chrX_122745048_f	0	+
+CHRX	152648964	152649196	CCDS14733.1_cds_0_0_chrX_152648965_r	0	-
+CHRX	152691446	152691471	CCDS14735.1_cds_0_0_chrX_152691447_f	0	+
+CHRX	152694029	152694263	CCDS14736.1_cds_0_0_chrX_152694030_r	0	-


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/eq-addvalue.dat
--- /dev/null
+++ b/test-data/eq-addvalue.dat
@@ -0,0 +1,65 @@
+chr1	147962192	147962580	CCDS989.1_cds_0_0_chr1_147962193_r	0	-	1
+chr1	147984545	147984630	CCDS990.1_cds_0_0_chr1_147984546_f	0	+	1
+chr1	148078400	148078582	CCDS993.1_cds_0_0_chr1_148078401_r	0	-	1
+chr1	148185136	148185276	CCDS996.1_cds_0_0_chr1_148185137_f	0	+	1
+chr10	55251623	55253124	CCDS7248.1_cds_0_0_chr10_55251624_r	0	-	1
+chr11	116124407	116124501	CCDS8374.1_cds_0_0_chr11_116124408_r	0	-	1
+chr11	116206508	116206563	CCDS8377.1_cds_0_0_chr11_116206509_f	0	+	1
+chr11	116211733	116212337	CCDS8378.1_cds_0_0_chr11_116211734_r	0	-	1
+chr11	1812377	1812407	CCDS7726.1_cds_0_0_chr11_1812378_f	0	+	1
+chr12	38440094	38440321	CCDS8736.1_cds_0_0_chr12_38440095_r	0	-	1
+chr13	112381694	112381953	CCDS9526.1_cds_0_0_chr13_112381695_f	0	+	1
+chr14	98710240	98712285	CCDS9949.1_cds_0_0_chr14_98710241_r	0	-	1
+chr15	41486872	41487060	CCDS10096.1_cds_0_0_chr15_41486873_r	0	-	1
+chr15	41673708	41673857	CCDS10097.1_cds_0_0_chr15_41673709_f	0	+	1
+chr15	41679161	41679250	CCDS10098.1_cds_0_0_chr15_41679162_r	0	-	1
+chr15	41826029	41826196	CCDS10101.1_cds_0_0_chr15_41826030_f	0	+	1
+chr16	142908	143003	CCDS10397.1_cds_0_0_chr16_142909_f	0	+	1
+chr16	179963	180135	CCDS10401.1_cds_0_0_chr16_179964_r	0	-	1
+chr16	244413	244681	CCDS10402.1_cds_0_0_chr16_244414_f	0	+	1
+chr16	259268	259383	CCDS10403.1_cds_0_0_chr16_259269_r	0	-	1
+chr18	23786114	23786321	CCDS11891.1_cds_0_0_chr18_23786115_r	0	-	1
+chr18	59406881	59407046	CCDS11985.1_cds_0_0_chr18_59406882_f	0	+	1
+chr18	59455932	59456337	CCDS11986.1_cds_0_0_chr18_59455933_r	0	-	1
+chr18	59600586	59600754	CCDS11988.1_cds_0_0_chr18_59600587_f	0	+	1
+chr19	59068595	59069564	CCDS12866.1_cds_0_0_chr19_59068596_f	0	+	1
+chr19	59236026	59236146	CCDS12872.1_cds_0_0_chr19_59236027_r	0	-	1
+chr19	59297998	59298008	CCDS12877.1_cds_0_0_chr19_59297999_f	0	+	1
+chr19	59302168	59302288	CCDS12878.1_cds_0_0_chr19_59302169_r	0	-	1
+chr2	118288583	118288668	CCDS2120.1_cds_0_0_chr2_118288584_f	0	+	1
+chr2	118394148	118394202	CCDS2121.1_cds_0_0_chr2_118394149_r	0	-	1
+chr2	220190202	220190242	CCDS2441.1_cds_0_0_chr2_220190203_f	0	+	1
+chr2	220229609	220230869	CCDS2443.1_cds_0_0_chr2_220229610_r	0	-	1
+chr20	33330413	33330423	CCDS13249.1_cds_0_0_chr20_33330414_r	0	-	1
+chr20	33513606	33513792	CCDS13255.1_cds_0_0_chr20_33513607_f	0	+	1
+chr20	33579500	33579527	CCDS13256.1_cds_0_0_chr20_33579501_r	0	-	1
+chr20	33593260	33593348	CCDS13257.1_cds_0_0_chr20_33593261_f	0	+	1
+chr21	32707032	32707192	CCDS13614.1_cds_0_0_chr21_32707033_f	0	+	1
+chr21	32869641	32870022	CCDS13615.1_cds_0_0_chr21_32869642_r	0	-	1
+chr21	33321040	33322012	CCDS13620.1_cds_0_0_chr21_33321041_f	0	+	1
+chr21	33744994	33745040	CCDS13625.1_cds_0_0_chr21_33744995_r	0	-	1
+chr22	30120223	30120265	CCDS13897.1_cds_0_0_chr22_30120224_f	0	+	1
+chr22	30160419	30160661	CCDS13898.1_cds_0_0_chr22_30160420_r	0	-	1
+chr22	30665273	30665360	CCDS13901.1_cds_0_0_chr22_30665274_f	0	+	1
+chr22	30939054	30939266	CCDS13903.1_cds_0_0_chr22_30939055_r	0	-	1
+chr5	131424298	131424460	CCDS4149.1_cds_0_0_chr5_131424299_f	0	+	1
+chr5	131556601	131556672	CCDS4151.1_cds_0_0_chr5_131556602_r	0	-	1
+chr5	131621326	131621419	CCDS4152.1_cds_0_0_chr5_131621327_f	0	+	1
+chr5	131847541	131847666	CCDS4155.1_cds_0_0_chr5_131847542_r	0	-	1
+chr6	108299600	108299744	CCDS5061.1_cds_0_0_chr6_108299601_r	0	-	1
+chr6	108594662	108594687	CCDS5063.1_cds_0_0_chr6_108594663_f	0	+	1
+chr6	108640045	108640151	CCDS5064.1_cds_0_0_chr6_108640046_r	0	-	1
+chr6	108722976	108723115	CCDS5067.1_cds_0_0_chr6_108722977_f	0	+	1
+chr7	113660517	113660685	CCDS5760.1_cds_0_0_chr7_113660518_f	0	+	1
+chr7	116512159	116512389	CCDS5771.1_cds_0_0_chr7_116512160_r	0	-	1
+chr7	116714099	116714152	CCDS5773.1_cds_0_0_chr7_116714100_f	0	+	1
+chr7	116945541	116945787	CCDS5774.1_cds_0_0_chr7_116945542_r	0	-	1
+chr8	118881131	118881317	CCDS6324.1_cds_0_0_chr8_118881132_r	0	-	1
+chr9	128764156	128764189	CCDS6914.1_cds_0_0_chr9_128764157_f	0	+	1
+chr9	128787519	128789136	CCDS6915.1_cds_0_0_chr9_128787520_r	0	-	1
+chr9	128882427	128882523	CCDS6917.1_cds_0_0_chr9_128882428_f	0	+	1
+chr9	128937229	128937445	CCDS6919.1_cds_0_0_chr9_128937230_r	0	-	1
+chrX	122745047	122745924	CCDS14606.1_cds_0_0_chrX_122745048_f	0	+	1
+chrX	152648964	152649196	CCDS14733.1_cds_0_0_chrX_152648965_r	0	-	1
+chrX	152691446	152691471	CCDS14735.1_cds_0_0_chrX_152691447_f	0	+	1
+chrX	152694029	152694263	CCDS14736.1_cds_0_0_chrX_152694030_r	0	-	1


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/eq-condense.dat
--- /dev/null
+++ b/test-data/eq-condense.dat
@@ -0,0 +1,65 @@
+chr1	147962192	147962580	CCDS989.1_cds_0_0_chr1_147962193_r	0	-
+chr1	147984545	147984630	CCDS990.1_cds_0_0_chr1_147984546_f	0	+
+chr1	148078400	148078582	CCDS993.1_cds_0_0_chr1_148078401_r	0	-
+chr1	148185136	148185276	CCDS996.1_cds_0_0_chr1_148185137_f	0	+
+chr10	55251623	55253124	CCDS7248.1_cds_0_0_chr10_55251624_r	0	-
+chr11	116124407	116124501	CCDS8374.1_cds_0_0_chr11_116124408_r	0	-
+chr11	116206508	116206563	CCDS8377.1_cds_0_0_chr11_116206509_f	0	+
+chr11	116211733	116212337	CCDS8378.1_cds_0_0_chr11_116211734_r	0	-
+chr11	1812377	1812407	CCDS7726.1_cds_0_0_chr11_1812378_f	0	+
+chr12	38440094	38440321	CCDS8736.1_cds_0_0_chr12_38440095_r	0	-
+chr13	112381694	112381953	CCDS9526.1_cds_0_0_chr13_112381695_f	0	+
+chr14	98710240	98712285	CCDS9949.1_cds_0_0_chr14_98710241_r	0	-
+chr15	41486872	41487060	CCDS10096.1_cds_0_0_chr15_41486873_r	0	-
+chr15	41673708	41673857	CCDS10097.1_cds_0_0_chr15_41673709_f	0	+
+chr15	41679161	41679250	CCDS10098.1_cds_0_0_chr15_41679162_r	0	-
+chr15	41826029	41826196	CCDS10101.1_cds_0_0_chr15_41826030_f	0	+
+chr16	142908	143003	CCDS10397.1_cds_0_0_chr16_142909_f	0	+
+chr16	179963	180135	CCDS10401.1_cds_0_0_chr16_179964_r	0	-
+chr16	244413	244681	CCDS10402.1_cds_0_0_chr16_244414_f	0	+
+chr16	259268	259383	CCDS10403.1_cds_0_0_chr16_259269_r	0	-
+chr18	23786114	23786321	CCDS11891.1_cds_0_0_chr18_23786115_r	0	-
+chr18	59406881	59407046	CCDS11985.1_cds_0_0_chr18_59406882_f	0	+
+chr18	59455932	59456337	CCDS11986.1_cds_0_0_chr18_59455933_r	0	-
+chr18	59600586	59600754	CCDS11988.1_cds_0_0_chr18_59600587_f	0	+
+chr19	59068595	59069564	CCDS12866.1_cds_0_0_chr19_59068596_f	0	+
+chr19	59236026	59236146	CCDS12872.1_cds_0_0_chr19_59236027_r	0	-
+chr19	59297998	59298008	CCDS12877.1_cds_0_0_chr19_59297999_f	0	+
+chr19	59302168	59302288	CCDS12878.1_cds_0_0_chr19_59302169_r	0	-
+chr2	118288583	118288668	CCDS2120.1_cds_0_0_chr2_118288584_f	0	+
+chr2	118394148	118394202	CCDS2121.1_cds_0_0_chr2_118394149_r	0	-
+chr2	220190202	220190242	CCDS2441.1_cds_0_0_chr2_220190203_f	0	+
+chr2	220229609	220230869	CCDS2443.1_cds_0_0_chr2_220229610_r	0	-
+chr20	33330413	33330423	CCDS13249.1_cds_0_0_chr20_33330414_r	0	-
+chr20	33513606	33513792	CCDS13255.1_cds_0_0_chr20_33513607_f	0	+
+chr20	33579500	33579527	CCDS13256.1_cds_0_0_chr20_33579501_r	0	-
+chr20	33593260	33593348	CCDS13257.1_cds_0_0_chr20_33593261_f	0	+
+chr21	32707032	32707192	CCDS13614.1_cds_0_0_chr21_32707033_f	0	+
+chr21	32869641	32870022	CCDS13615.1_cds_0_0_chr21_32869642_r	0	-
+chr21	33321040	33322012	CCDS13620.1_cds_0_0_chr21_33321041_f	0	+
+chr21	33744994	33745040	CCDS13625.1_cds_0_0_chr21_33744995_r	0	-
+chr22	30120223	30120265	CCDS13897.1_cds_0_0_chr22_30120224_f	0	+
+chr22	30160419	30160661	CCDS13898.1_cds_0_0_chr22_30160420_r	0	-
+chr22	30665273	30665360	CCDS13901.1_cds_0_0_chr22_30665274_f	0	+
+chr22	30939054	30939266	CCDS13903.1_cds_0_0_chr22_30939055_r	0	-
+chr5	131424298	131424460	CCDS4149.1_cds_0_0_chr5_131424299_f	0	+
+chr5	131556601	131556672	CCDS4151.1_cds_0_0_chr5_131556602_r	0	-
+chr5	131621326	131621419	CCDS4152.1_cds_0_0_chr5_131621327_f	0	+
+chr5	131847541	131847666	CCDS4155.1_cds_0_0_chr5_131847542_r	0	-
+chr6	108299600	108299744	CCDS5061.1_cds_0_0_chr6_108299601_r	0	-
+chr6	108594662	108594687	CCDS5063.1_cds_0_0_chr6_108594663_f	0	+
+chr6	108640045	108640151	CCDS5064.1_cds_0_0_chr6_108640046_r	0	-
+chr6	108722976	108723115	CCDS5067.1_cds_0_0_chr6_108722977_f	0	+
+chr7	113660517	113660685	CCDS5760.1_cds_0_0_chr7_113660518_f	0	+
+chr7	116512159	116512389	CCDS5771.1_cds_0_0_chr7_116512160_r	0	-
+chr7	116714099	116714152	CCDS5773.1_cds_0_0_chr7_116714100_f	0	+
+chr7	116945541	116945787	CCDS5774.1_cds_0_0_chr7_116945542_r	0	-
+chr8	118881131	118881317	CCDS6324.1_cds_0_0_chr8_118881132_r	0	-
+chr9	128764156	128764189	CCDS6914.1_cds_0_0_chr9_128764157_f	0	+
+chr9	128787519	128789136	CCDS6915.1_cds_0_0_chr9_128787520_r	0	-
+chr9	128882427	128882523	CCDS6917.1_cds_0_0_chr9_128882428_f	0	+
+chr9	128937229	128937445	CCDS6919.1_cds_0_0_chr9_128937230_r	0	-
+chrX	122745047	122745924	CCDS14606.1_cds_0_0_chrX_122745048_f	0	+
+chrX	152648964	152649196	CCDS14733.1_cds_0_0_chrX_152648965_r	0	-
+chrX	152691446	152691471	CCDS14735.1_cds_0_0_chrX_152691447_f	0	+
+chrX	152694029	152694263	CCDS14736.1_cds_0_0_chrX_152694030_r	0	-


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/eq-convert.dat
--- /dev/null
+++ b/test-data/eq-convert.dat
@@ -0,0 +1,65 @@
+chr1	147962192	147962580	CCDS989.1_cds_0_0_chr1_147962193_r	0	-
+chr1	147984545	147984630	CCDS990.1_cds_0_0_chr1_147984546_f	0	+
+chr1	148078400	148078582	CCDS993.1_cds_0_0_chr1_148078401_r	0	-
+chr1	148185136	148185276	CCDS996.1_cds_0_0_chr1_148185137_f	0	+
+chr10	55251623	55253124	CCDS7248.1_cds_0_0_chr10_55251624_r	0	-
+chr11	116124407	116124501	CCDS8374.1_cds_0_0_chr11_116124408_r	0	-
+chr11	116206508	116206563	CCDS8377.1_cds_0_0_chr11_116206509_f	0	+
+chr11	116211733	116212337	CCDS8378.1_cds_0_0_chr11_116211734_r	0	-
+chr11	1812377	1812407	CCDS7726.1_cds_0_0_chr11_1812378_f	0	+
+chr12	38440094	38440321	CCDS8736.1_cds_0_0_chr12_38440095_r	0	-
+chr13	112381694	112381953	CCDS9526.1_cds_0_0_chr13_112381695_f	0	+
+chr14	98710240	98712285	CCDS9949.1_cds_0_0_chr14_98710241_r	0	-
+chr15	41486872	41487060	CCDS10096.1_cds_0_0_chr15_41486873_r	0	-
+chr15	41673708	41673857	CCDS10097.1_cds_0_0_chr15_41673709_f	0	+
+chr15	41679161	41679250	CCDS10098.1_cds_0_0_chr15_41679162_r	0	-
+chr15	41826029	41826196	CCDS10101.1_cds_0_0_chr15_41826030_f	0	+
+chr16	142908	143003	CCDS10397.1_cds_0_0_chr16_142909_f	0	+
+chr16	179963	180135	CCDS10401.1_cds_0_0_chr16_179964_r	0	-
+chr16	244413	244681	CCDS10402.1_cds_0_0_chr16_244414_f	0	+
+chr16	259268	259383	CCDS10403.1_cds_0_0_chr16_259269_r	0	-
+chr18	23786114	23786321	CCDS11891.1_cds_0_0_chr18_23786115_r	0	-
+chr18	59406881	59407046	CCDS11985.1_cds_0_0_chr18_59406882_f	0	+
+chr18	59455932	59456337	CCDS11986.1_cds_0_0_chr18_59455933_r	0	-
+chr18	59600586	59600754	CCDS11988.1_cds_0_0_chr18_59600587_f	0	+
+chr19	59068595	59069564	CCDS12866.1_cds_0_0_chr19_59068596_f	0	+
+chr19	59236026	59236146	CCDS12872.1_cds_0_0_chr19_59236027_r	0	-
+chr19	59297998	59298008	CCDS12877.1_cds_0_0_chr19_59297999_f	0	+
+chr19	59302168	59302288	CCDS12878.1_cds_0_0_chr19_59302169_r	0	-
+chr2	118288583	118288668	CCDS2120.1_cds_0_0_chr2_118288584_f	0	+
+chr2	118394148	118394202	CCDS2121.1_cds_0_0_chr2_118394149_r	0	-
+chr2	220190202	220190242	CCDS2441.1_cds_0_0_chr2_220190203_f	0	+
+chr2	220229609	220230869	CCDS2443.1_cds_0_0_chr2_220229610_r	0	-
+chr20	33330413	33330423	CCDS13249.1_cds_0_0_chr20_33330414_r	0	-
+chr20	33513606	33513792	CCDS13255.1_cds_0_0_chr20_33513607_f	0	+
+chr20	33579500	33579527	CCDS13256.1_cds_0_0_chr20_33579501_r	0	-
+chr20	33593260	33593348	CCDS13257.1_cds_0_0_chr20_33593261_f	0	+
+chr21	32707032	32707192	CCDS13614.1_cds_0_0_chr21_32707033_f	0	+
+chr21	32869641	32870022	CCDS13615.1_cds_0_0_chr21_32869642_r	0	-
+chr21	33321040	33322012	CCDS13620.1_cds_0_0_chr21_33321041_f	0	+
+chr21	33744994	33745040	CCDS13625.1_cds_0_0_chr21_33744995_r	0	-
+chr22	30120223	30120265	CCDS13897.1_cds_0_0_chr22_30120224_f	0	+
+chr22	30160419	30160661	CCDS13898.1_cds_0_0_chr22_30160420_r	0	-
+chr22	30665273	30665360	CCDS13901.1_cds_0_0_chr22_30665274_f	0	+
+chr22	30939054	30939266	CCDS13903.1_cds_0_0_chr22_30939055_r	0	-
+chr5	131424298	131424460	CCDS4149.1_cds_0_0_chr5_131424299_f	0	+
+chr5	131556601	131556672	CCDS4151.1_cds_0_0_chr5_131556602_r	0	-
+chr5	131621326	131621419	CCDS4152.1_cds_0_0_chr5_131621327_f	0	+
+chr5	131847541	131847666	CCDS4155.1_cds_0_0_chr5_131847542_r	0	-
+chr6	108299600	108299744	CCDS5061.1_cds_0_0_chr6_108299601_r	0	-
+chr6	108594662	108594687	CCDS5063.1_cds_0_0_chr6_108594663_f	0	+
+chr6	108640045	108640151	CCDS5064.1_cds_0_0_chr6_108640046_r	0	-
+chr6	108722976	108723115	CCDS5067.1_cds_0_0_chr6_108722977_f	0	+
+chr7	113660517	113660685	CCDS5760.1_cds_0_0_chr7_113660518_f	0	+
+chr7	116512159	116512389	CCDS5771.1_cds_0_0_chr7_116512160_r	0	-
+chr7	116714099	116714152	CCDS5773.1_cds_0_0_chr7_116714100_f	0	+
+chr7	116945541	116945787	CCDS5774.1_cds_0_0_chr7_116945542_r	0	-
+chr8	118881131	118881317	CCDS6324.1_cds_0_0_chr8_118881132_r	0	-
+chr9	128764156	128764189	CCDS6914.1_cds_0_0_chr9_128764157_f	0	+
+chr9	128787519	128789136	CCDS6915.1_cds_0_0_chr9_128787520_r	0	-
+chr9	128882427	128882523	CCDS6917.1_cds_0_0_chr9_128882428_f	0	+
+chr9	128937229	128937445	CCDS6919.1_cds_0_0_chr9_128937230_r	0	-
+chrX	122745047	122745924	CCDS14606.1_cds_0_0_chrX_122745048_f	0	+
+chrX	152648964	152649196	CCDS14733.1_cds_0_0_chrX_152648965_r	0	-
+chrX	152691446	152691471	CCDS14735.1_cds_0_0_chrX_152691447_f	0	+
+chrX	152694029	152694263	CCDS14736.1_cds_0_0_chrX_152694030_r	0	-


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/eq-cut.dat
--- /dev/null
+++ b/test-data/eq-cut.dat
@@ -0,0 +1,65 @@
+chr1	CCDS989.1_cds_0_0_chr1_147962193_r	147962192	147962580
+chr1	CCDS990.1_cds_0_0_chr1_147984546_f	147984545	147984630
+chr1	CCDS993.1_cds_0_0_chr1_148078401_r	148078400	148078582
+chr1	CCDS996.1_cds_0_0_chr1_148185137_f	148185136	148185276
+chr10	CCDS7248.1_cds_0_0_chr10_55251624_r	55251623	55253124
+chr11	CCDS8374.1_cds_0_0_chr11_116124408_r	116124407	116124501
+chr11	CCDS8377.1_cds_0_0_chr11_116206509_f	116206508	116206563
+chr11	CCDS8378.1_cds_0_0_chr11_116211734_r	116211733	116212337
+chr11	CCDS7726.1_cds_0_0_chr11_1812378_f	1812377	1812407
+chr12	CCDS8736.1_cds_0_0_chr12_38440095_r	38440094	38440321
+chr13	CCDS9526.1_cds_0_0_chr13_112381695_f	112381694	112381953
+chr14	CCDS9949.1_cds_0_0_chr14_98710241_r	98710240	98712285
+chr15	CCDS10096.1_cds_0_0_chr15_41486873_r	41486872	41487060
+chr15	CCDS10097.1_cds_0_0_chr15_41673709_f	41673708	41673857
+chr15	CCDS10098.1_cds_0_0_chr15_41679162_r	41679161	41679250
+chr15	CCDS10101.1_cds_0_0_chr15_41826030_f	41826029	41826196
+chr16	CCDS10397.1_cds_0_0_chr16_142909_f	142908	143003
+chr16	CCDS10401.1_cds_0_0_chr16_179964_r	179963	180135
+chr16	CCDS10402.1_cds_0_0_chr16_244414_f	244413	244681
+chr16	CCDS10403.1_cds_0_0_chr16_259269_r	259268	259383
+chr18	CCDS11891.1_cds_0_0_chr18_23786115_r	23786114	23786321
+chr18	CCDS11985.1_cds_0_0_chr18_59406882_f	59406881	59407046
+chr18	CCDS11986.1_cds_0_0_chr18_59455933_r	59455932	59456337
+chr18	CCDS11988.1_cds_0_0_chr18_59600587_f	59600586	59600754
+chr19	CCDS12866.1_cds_0_0_chr19_59068596_f	59068595	59069564
+chr19	CCDS12872.1_cds_0_0_chr19_59236027_r	59236026	59236146
+chr19	CCDS12877.1_cds_0_0_chr19_59297999_f	59297998	59298008
+chr19	CCDS12878.1_cds_0_0_chr19_59302169_r	59302168	59302288
+chr2	CCDS2120.1_cds_0_0_chr2_118288584_f	118288583	118288668
+chr2	CCDS2121.1_cds_0_0_chr2_118394149_r	118394148	118394202
+chr2	CCDS2441.1_cds_0_0_chr2_220190203_f	220190202	220190242
+chr2	CCDS2443.1_cds_0_0_chr2_220229610_r	220229609	220230869
+chr20	CCDS13249.1_cds_0_0_chr20_33330414_r	33330413	33330423
+chr20	CCDS13255.1_cds_0_0_chr20_33513607_f	33513606	33513792
+chr20	CCDS13256.1_cds_0_0_chr20_33579501_r	33579500	33579527
+chr20	CCDS13257.1_cds_0_0_chr20_33593261_f	33593260	33593348
+chr21	CCDS13614.1_cds_0_0_chr21_32707033_f	32707032	32707192
+chr21	CCDS13615.1_cds_0_0_chr21_32869642_r	32869641	32870022
+chr21	CCDS13620.1_cds_0_0_chr21_33321041_f	33321040	33322012
+chr21	CCDS13625.1_cds_0_0_chr21_33744995_r	33744994	33745040
+chr22	CCDS13897.1_cds_0_0_chr22_30120224_f	30120223	30120265
+chr22	CCDS13898.1_cds_0_0_chr22_30160420_r	30160419	30160661
+chr22	CCDS13901.1_cds_0_0_chr22_30665274_f	30665273	30665360
+chr22	CCDS13903.1_cds_0_0_chr22_30939055_r	30939054	30939266
+chr5	CCDS4149.1_cds_0_0_chr5_131424299_f	131424298	131424460
+chr5	CCDS4151.1_cds_0_0_chr5_131556602_r	131556601	131556672
+chr5	CCDS4152.1_cds_0_0_chr5_131621327_f	131621326	131621419
+chr5	CCDS4155.1_cds_0_0_chr5_131847542_r	131847541	131847666
+chr6	CCDS5061.1_cds_0_0_chr6_108299601_r	108299600	108299744
+chr6	CCDS5063.1_cds_0_0_chr6_108594663_f	108594662	108594687
+chr6	CCDS5064.1_cds_0_0_chr6_108640046_r	108640045	108640151
+chr6	CCDS5067.1_cds_0_0_chr6_108722977_f	108722976	108723115
+chr7	CCDS5760.1_cds_0_0_chr7_113660518_f	113660517	113660685
+chr7	CCDS5771.1_cds_0_0_chr7_116512160_r	116512159	116512389
+chr7	CCDS5773.1_cds_0_0_chr7_116714100_f	116714099	116714152
+chr7	CCDS5774.1_cds_0_0_chr7_116945542_r	116945541	116945787
+chr8	CCDS6324.1_cds_0_0_chr8_118881132_r	118881131	118881317
+chr9	CCDS6914.1_cds_0_0_chr9_128764157_f	128764156	128764189
+chr9	CCDS6915.1_cds_0_0_chr9_128787520_r	128787519	128789136
+chr9	CCDS6917.1_cds_0_0_chr9_128882428_f	128882427	128882523
+chr9	CCDS6919.1_cds_0_0_chr9_128937230_r	128937229	128937445
+chrX	CCDS14606.1_cds_0_0_chrX_122745048_f	122745047	122745924
+chrX	CCDS14733.1_cds_0_0_chrX_152648965_r	152648964	152649196
+chrX	CCDS14735.1_cds_0_0_chrX_152691447_f	152691446	152691471
+chrX	CCDS14736.1_cds_0_0_chrX_152694030_r	152694029	152694263


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/mergeCols.dat
--- /dev/null
+++ b/test-data/mergeCols.dat
@@ -0,0 +1,65 @@
+chr1	147962192	147962580	CCDS989.1_cds_0_0_chr1_147962193_r	0	-	CCDS989.1_cds_0_0_chr1_147962193_rchr1-
+chr1	147984545	147984630	CCDS990.1_cds_0_0_chr1_147984546_f	0	+	CCDS990.1_cds_0_0_chr1_147984546_fchr1+
+chr1	148078400	148078582	CCDS993.1_cds_0_0_chr1_148078401_r	0	-	CCDS993.1_cds_0_0_chr1_148078401_rchr1-
+chr1	148185136	148185276	CCDS996.1_cds_0_0_chr1_148185137_f	0	+	CCDS996.1_cds_0_0_chr1_148185137_fchr1+
+chr10	55251623	55253124	CCDS7248.1_cds_0_0_chr10_55251624_r	0	-	CCDS7248.1_cds_0_0_chr10_55251624_rchr10-
+chr11	116124407	116124501	CCDS8374.1_cds_0_0_chr11_116124408_r	0	-	CCDS8374.1_cds_0_0_chr11_116124408_rchr11-
+chr11	116206508	116206563	CCDS8377.1_cds_0_0_chr11_116206509_f	0	+	CCDS8377.1_cds_0_0_chr11_116206509_fchr11+
+chr11	116211733	116212337	CCDS8378.1_cds_0_0_chr11_116211734_r	0	-	CCDS8378.1_cds_0_0_chr11_116211734_rchr11-
+chr11	1812377	1812407	CCDS7726.1_cds_0_0_chr11_1812378_f	0	+	CCDS7726.1_cds_0_0_chr11_1812378_fchr11+
+chr12	38440094	38440321	CCDS8736.1_cds_0_0_chr12_38440095_r	0	-	CCDS8736.1_cds_0_0_chr12_38440095_rchr12-
+chr13	112381694	112381953	CCDS9526.1_cds_0_0_chr13_112381695_f	0	+	CCDS9526.1_cds_0_0_chr13_112381695_fchr13+
+chr14	98710240	98712285	CCDS9949.1_cds_0_0_chr14_98710241_r	0	-	CCDS9949.1_cds_0_0_chr14_98710241_rchr14-
+chr15	41486872	41487060	CCDS10096.1_cds_0_0_chr15_41486873_r	0	-	CCDS10096.1_cds_0_0_chr15_41486873_rchr15-
+chr15	41673708	41673857	CCDS10097.1_cds_0_0_chr15_41673709_f	0	+	CCDS10097.1_cds_0_0_chr15_41673709_fchr15+
+chr15	41679161	41679250	CCDS10098.1_cds_0_0_chr15_41679162_r	0	-	CCDS10098.1_cds_0_0_chr15_41679162_rchr15-
+chr15	41826029	41826196	CCDS10101.1_cds_0_0_chr15_41826030_f	0	+	CCDS10101.1_cds_0_0_chr15_41826030_fchr15+
+chr16	142908	143003	CCDS10397.1_cds_0_0_chr16_142909_f	0	+	CCDS10397.1_cds_0_0_chr16_142909_fchr16+
+chr16	179963	180135	CCDS10401.1_cds_0_0_chr16_179964_r	0	-	CCDS10401.1_cds_0_0_chr16_179964_rchr16-
+chr16	244413	244681	CCDS10402.1_cds_0_0_chr16_244414_f	0	+	CCDS10402.1_cds_0_0_chr16_244414_fchr16+
+chr16	259268	259383	CCDS10403.1_cds_0_0_chr16_259269_r	0	-	CCDS10403.1_cds_0_0_chr16_259269_rchr16-
+chr18	23786114	23786321	CCDS11891.1_cds_0_0_chr18_23786115_r	0	-	CCDS11891.1_cds_0_0_chr18_23786115_rchr18-
+chr18	59406881	59407046	CCDS11985.1_cds_0_0_chr18_59406882_f	0	+	CCDS11985.1_cds_0_0_chr18_59406882_fchr18+
+chr18	59455932	59456337	CCDS11986.1_cds_0_0_chr18_59455933_r	0	-	CCDS11986.1_cds_0_0_chr18_59455933_rchr18-
+chr18	59600586	59600754	CCDS11988.1_cds_0_0_chr18_59600587_f	0	+	CCDS11988.1_cds_0_0_chr18_59600587_fchr18+
+chr19	59068595	59069564	CCDS12866.1_cds_0_0_chr19_59068596_f	0	+	CCDS12866.1_cds_0_0_chr19_59068596_fchr19+
+chr19	59236026	59236146	CCDS12872.1_cds_0_0_chr19_59236027_r	0	-	CCDS12872.1_cds_0_0_chr19_59236027_rchr19-
+chr19	59297998	59298008	CCDS12877.1_cds_0_0_chr19_59297999_f	0	+	CCDS12877.1_cds_0_0_chr19_59297999_fchr19+
+chr19	59302168	59302288	CCDS12878.1_cds_0_0_chr19_59302169_r	0	-	CCDS12878.1_cds_0_0_chr19_59302169_rchr19-
+chr2	118288583	118288668	CCDS2120.1_cds_0_0_chr2_118288584_f	0	+	CCDS2120.1_cds_0_0_chr2_118288584_fchr2+
+chr2	118394148	118394202	CCDS2121.1_cds_0_0_chr2_118394149_r	0	-	CCDS2121.1_cds_0_0_chr2_118394149_rchr2-
+chr2	220190202	220190242	CCDS2441.1_cds_0_0_chr2_220190203_f	0	+	CCDS2441.1_cds_0_0_chr2_220190203_fchr2+
+chr2	220229609	220230869	CCDS2443.1_cds_0_0_chr2_220229610_r	0	-	CCDS2443.1_cds_0_0_chr2_220229610_rchr2-
+chr20	33330413	33330423	CCDS13249.1_cds_0_0_chr20_33330414_r	0	-	CCDS13249.1_cds_0_0_chr20_33330414_rchr20-
+chr20	33513606	33513792	CCDS13255.1_cds_0_0_chr20_33513607_f	0	+	CCDS13255.1_cds_0_0_chr20_33513607_fchr20+
+chr20	33579500	33579527	CCDS13256.1_cds_0_0_chr20_33579501_r	0	-	CCDS13256.1_cds_0_0_chr20_33579501_rchr20-
+chr20	33593260	33593348	CCDS13257.1_cds_0_0_chr20_33593261_f	0	+	CCDS13257.1_cds_0_0_chr20_33593261_fchr20+
+chr21	32707032	32707192	CCDS13614.1_cds_0_0_chr21_32707033_f	0	+	CCDS13614.1_cds_0_0_chr21_32707033_fchr21+
+chr21	32869641	32870022	CCDS13615.1_cds_0_0_chr21_32869642_r	0	-	CCDS13615.1_cds_0_0_chr21_32869642_rchr21-
+chr21	33321040	33322012	CCDS13620.1_cds_0_0_chr21_33321041_f	0	+	CCDS13620.1_cds_0_0_chr21_33321041_fchr21+
+chr21	33744994	33745040	CCDS13625.1_cds_0_0_chr21_33744995_r	0	-	CCDS13625.1_cds_0_0_chr21_33744995_rchr21-
+chr22	30120223	30120265	CCDS13897.1_cds_0_0_chr22_30120224_f	0	+	CCDS13897.1_cds_0_0_chr22_30120224_fchr22+
+chr22	30160419	30160661	CCDS13898.1_cds_0_0_chr22_30160420_r	0	-	CCDS13898.1_cds_0_0_chr22_30160420_rchr22-
+chr22	30665273	30665360	CCDS13901.1_cds_0_0_chr22_30665274_f	0	+	CCDS13901.1_cds_0_0_chr22_30665274_fchr22+
+chr22	30939054	30939266	CCDS13903.1_cds_0_0_chr22_30939055_r	0	-	CCDS13903.1_cds_0_0_chr22_30939055_rchr22-
+chr5	131424298	131424460	CCDS4149.1_cds_0_0_chr5_131424299_f	0	+	CCDS4149.1_cds_0_0_chr5_131424299_fchr5+
+chr5	131556601	131556672	CCDS4151.1_cds_0_0_chr5_131556602_r	0	-	CCDS4151.1_cds_0_0_chr5_131556602_rchr5-
+chr5	131621326	131621419	CCDS4152.1_cds_0_0_chr5_131621327_f	0	+	CCDS4152.1_cds_0_0_chr5_131621327_fchr5+
+chr5	131847541	131847666	CCDS4155.1_cds_0_0_chr5_131847542_r	0	-	CCDS4155.1_cds_0_0_chr5_131847542_rchr5-
+chr6	108299600	108299744	CCDS5061.1_cds_0_0_chr6_108299601_r	0	-	CCDS5061.1_cds_0_0_chr6_108299601_rchr6-
+chr6	108594662	108594687	CCDS5063.1_cds_0_0_chr6_108594663_f	0	+	CCDS5063.1_cds_0_0_chr6_108594663_fchr6+
+chr6	108640045	108640151	CCDS5064.1_cds_0_0_chr6_108640046_r	0	-	CCDS5064.1_cds_0_0_chr6_108640046_rchr6-
+chr6	108722976	108723115	CCDS5067.1_cds_0_0_chr6_108722977_f	0	+	CCDS5067.1_cds_0_0_chr6_108722977_fchr6+
+chr7	113660517	113660685	CCDS5760.1_cds_0_0_chr7_113660518_f	0	+	CCDS5760.1_cds_0_0_chr7_113660518_fchr7+
+chr7	116512159	116512389	CCDS5771.1_cds_0_0_chr7_116512160_r	0	-	CCDS5771.1_cds_0_0_chr7_116512160_rchr7-
+chr7	116714099	116714152	CCDS5773.1_cds_0_0_chr7_116714100_f	0	+	CCDS5773.1_cds_0_0_chr7_116714100_fchr7+
+chr7	116945541	116945787	CCDS5774.1_cds_0_0_chr7_116945542_r	0	-	CCDS5774.1_cds_0_0_chr7_116945542_rchr7-
+chr8	118881131	118881317	CCDS6324.1_cds_0_0_chr8_118881132_r	0	-	CCDS6324.1_cds_0_0_chr8_118881132_rchr8-
+chr9	128764156	128764189	CCDS6914.1_cds_0_0_chr9_128764157_f	0	+	CCDS6914.1_cds_0_0_chr9_128764157_fchr9+
+chr9	128787519	128789136	CCDS6915.1_cds_0_0_chr9_128787520_r	0	-	CCDS6915.1_cds_0_0_chr9_128787520_rchr9-
+chr9	128882427	128882523	CCDS6917.1_cds_0_0_chr9_128882428_f	0	+	CCDS6917.1_cds_0_0_chr9_128882428_fchr9+
+chr9	128937229	128937445	CCDS6919.1_cds_0_0_chr9_128937230_r	0	-	CCDS6919.1_cds_0_0_chr9_128937230_rchr9-
+chrX	122745047	122745924	CCDS14606.1_cds_0_0_chrX_122745048_f	0	+	CCDS14606.1_cds_0_0_chrX_122745048_fchrX+
+chrX	152648964	152649196	CCDS14733.1_cds_0_0_chrX_152648965_r	0	-	CCDS14733.1_cds_0_0_chrX_152648965_rchrX-
+chrX	152691446	152691471	CCDS14735.1_cds_0_0_chrX_152691447_f	0	+	CCDS14735.1_cds_0_0_chrX_152691447_fchrX+
+chrX	152694029	152694263	CCDS14736.1_cds_0_0_chrX_152694030_r	0	-	CCDS14736.1_cds_0_0_chrX_152694030_rchrX-


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/trimmer_a_f_c0_s1_e13_i62.dat
--- /dev/null
+++ b/test-data/trimmer_a_f_c0_s1_e13_i62.dat
@@ -0,0 +1,5 @@
+12345	abcdef	
+67890	ghjkl	g
+>assa	lljlj	ljlj
+sasas	hghg	hg
+@dgf	gfgf	gfg


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/trimmer_a_f_c2_s1_e2_i62.dat
--- /dev/null
+++ b/test-data/trimmer_a_f_c2_s1_e2_i62.dat
@@ -0,0 +1,5 @@
+12345	ab	xyz
+67890	gh	ghjt
+>assa	lljlj	ljlj
+sasas	hg	hghg
+@dgf	gf	gfgf


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 test-data/trimmer_tab_delimited.dat
--- /dev/null
+++ b/test-data/trimmer_tab_delimited.dat
@@ -0,0 +1,5 @@
+12345	abcdef	xyz
+67890	ghjkl	ghjt
+>assa	lljlj	ljlj
+sasas	hghg	hghg
+@dgf	gfgf	gfgf


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tool_conf.xml.sample
--- a/tool_conf.xml.sample
+++ b/tool_conf.xml.sample
@@ -44,12 +44,21 @@
     <tool file="extract/liftOver_wrapper.xml" /></section><section name="Text Manipulation" id="textutil">
+    <tool file="filters/fixedValueColumn.xml" /><tool file="stats/column_maker.xml" /><tool file="filters/catWrapper.xml" /><tool file="filters/cutWrapper.xml" />
+    <tool file="filters/mergeCols.xml" />
+    <tool file="filters/convert_characters.xml" /><tool file="filters/CreateInterval.xml" />
+    <tool file="filters/cutWrapper.xml" />
+    <tool file="filters/changeCase.xml" /><tool file="filters/pasteWrapper.xml" />
+    <tool file="filters/remove_beginning.xml" /><tool file="filters/randomlines.xml" />
+    <tool file="filters/headWrapper.xml" />
+    <tool file="filters/tailWrapper.xml" />
+    <tool file="filters/trimmer.xml" /><tool file="filters/wc_gnu.xml" /><tool file="filters/secure_hash_message_digest.xml" /><tool file="stats/dna_filtering.xml" />


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/changeCase.pl
--- /dev/null
+++ b/tools/filters/changeCase.pl
@@ -0,0 +1,58 @@
+#! /usr/bin/perl -w
+
+use strict;
+use warnings;
+
+my $columns = {};
+my $del = "";
+my @in = ();
+my @out = ();
+my $command = "";
+my $field = 0;
+
+# a wrapper for changing the case of columns from within galaxy
+# isaChangeCase.pl [filename] [columns] [delim] [casing] [output]
+
+die "Check arguments: $0 [filename] [columns] [delim] [casing] [output]\n" unless @ARGV == 5;
+
+# process column input
+$ARGV[1] =~ s/\s+//g;
+foreach ( split /,/, $ARGV[1] ) {
+  if (m/^c\d{1,}$/i) {
+    s/c//ig;
+    $columns->{$_} = --$_;
+  }
+}
+
+die "No columns specified, columns are not preceeded with 'c', or commas are not used to separate column numbers: $ARGV[1]\n" if keys %$columns == 0;
+
+my $column_delimiters_href = {
+	'TAB' => q{\t},
+	'COMMA' => ",",
+	'DASH' => "-",
+	'UNDERSCORE' => "_",
+	'PIPE' => q{\|},
+	'DOT' => q{\.},
+	'SPACE' => q{\s+}
+};
+	
+$del = $column_delimiters_href->{$ARGV[2]};
+
+open (OUT, ">$ARGV[4]") or die "Cannot create $ARGV[4]:$!\n";
+open (IN,  "<$ARGV[0]") or die "Cannot open $ARGV[0]:$!\n";
+while (<IN>) {
+  chop;
+  @in = split /$del/; 
+  for ( my $i = 0; $i <= $#in; ++$i) {
+	if (exists $columns->{$i}) {
+		push(@out, $ARGV[3] eq 'up' ? uc($in[$i]) : lc($in[$i]));
+	} else {
+		push(@out, $in[$i]);
+	}
+  }
+  print OUT join("\t",@out), "\n";
+  @out = ();
+}
+close IN;
+
+close OUT;


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/changeCase.xml
--- /dev/null
+++ b/tools/filters/changeCase.xml
@@ -0,0 +1,77 @@
+<tool id="ChangeCase" name="Change Case">
+  <description> of selected columns</description>
+  <stdio>
+    <exit_code range="1:" err_level="fatal" />
+  </stdio>
+  <command interpreter="perl">changeCase.pl $input "$cols" $delimiter $casing $out_file1</command>
+  <inputs>
+    <param name="input" format="txt" type="data" label="From"/>
+    <param name="cols" size="10" type="text" value="c1,c2" label="Change case of columns"/>
+    <param name="delimiter" type="select" label="Delimited by">
+      <option value="TAB">Tab</option>
+      <option value="SPACE">Whitespace</option>
+      <option value="DOT">Dot</option>
+      <option value="COMMA">Comma</option>
+      <option value="DASH">Dash</option>
+      <option value="UNDERSCORE">Underscore</option>
+      <option value="PIPE">Pipe</option>
+    </param>
+    <param name="casing" type="select" label="To">
+      <option value="up">Upper case</option>
+      <option value="lo">Lower case</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input" value="1.txt" ftype="txt"/>
+      <param name="cols" value="c1"/>
+      <param name="delimiter" value="SPACE"/>
+      <param name="casing" value="up"/>
+      <output name="out_file1" file="changeCase_out1.tabular"/>
+    </test>
+    <test>
+      <param name="input" value="1.bed" ftype="bed"/>
+      <param name="cols" value="c1"/>
+      <param name="delimiter" value="TAB"/>
+      <param name="casing" value="up"/>
+      <output name="out_file1" file="changeCase_out2.tabular"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+**This tool breaks column assignments.** To re-establish column assignments run the tool and click on the pencil icon in the resulting history item.
+
+.. class:: warningmark
+
+The format of the resulting dataset from this tool is always tabular.
+
+-----
+
+**What it does**
+
+This tool selects specified columns from a dataset and converts the values of those columns to upper or lower case.
+
+- Columns are specified as **c1**, **c2**, and so on.
+- Columns can be specified in any order (e.g., **c2,c1,c6**)
+
+-----
+
+**Example**
+
+Changing columns 1 and 3 ( delimited by Comma ) to upper case in::
+
+  apple,is,good
+  windows,is,bad
+
+will result in::
+
+  APPLE is GOOD
+  WINDOWS is BAD
+
+  </help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/condense_characters.pl
--- /dev/null
+++ b/tools/filters/condense_characters.pl
@@ -0,0 +1,105 @@
+#! /usr/bin/perl -w
+
+use strict;
+use warnings;
+
+# condenses all consecutive characters of one type
+# convert_characters.pl [input] [character] [output]
+
+die "Check arguments" unless @ARGV == 3;
+
+my $inputfile = $ARGV[0];
+my $character = $ARGV[1];
+my $outputfile = $ARGV[2];
+
+
+my $convert_from;
+my $convert_to;
+
+
+if ($character eq "s")
+{
+    $convert_from = '\s';
+}
+elsif ($character eq "T")
+{
+    $convert_from = '\t';
+}
+elsif ($character eq "Sp")
+{
+    $convert_from = " ";
+}
+elsif ($character eq "Dt")
+{
+    $convert_from = '\.';
+}
+elsif ($character eq "C")
+{
+    $convert_from = ",";
+}
+elsif ($character eq "D")
+{
+    $convert_from = "-";
+}
+elsif ($character eq "U")
+{
+    $convert_from = "_";
+}
+elsif ($character eq "P")
+{
+    $convert_from = '\|';
+}
+else
+{
+    die "Invalid value specified for convert from\n";
+}
+
+
+if ($character eq "T")
+{
+    $convert_to = "\t";
+}
+elsif ($character eq "Sp")
+{
+    $convert_to = " ";
+}
+elsif ($character eq "Dt")
+{
+    $convert_to = "\.";
+}
+elsif ($character eq "C")
+{
+    $convert_to = ",";
+}
+elsif ($character eq "D")
+{
+    $convert_to = "-";
+}
+elsif ($character eq "U")
+{
+    $convert_to = "_";
+}
+elsif ($character eq "P")
+{
+    $convert_to = "|";
+}
+else
+{
+    die "Invalid value specified for Convert to\n";
+}
+
+my $fhIn;
+open ($fhIn, "< $inputfile") or die "Cannot open source file";
+
+my $fhOut;
+open ($fhOut, "> $outputfile");
+
+while (<$fhIn>)
+{
+    my $thisLine = $_;
+    chomp $thisLine;
+    $thisLine =~ s/${convert_from}+/$convert_to/g;
+    print $fhOut $thisLine,"\n";    
+}
+close ($fhIn) or die "Cannot close source file";
+close ($fhOut) or die "Cannot close output file";


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/condense_characters.xml
--- /dev/null
+++ b/tools/filters/condense_characters.xml
@@ -0,0 +1,48 @@
+<tool id="Condense characters1" name="Condense">
+  <description>consecutive characters</description>
+  <command interpreter="perl">condense_characters.pl $input $character $out_file1</command>
+  <inputs>
+<!--    <display>condense all consecutive $character from $input</display> -->
+    <param name="character" type="select" label="Condense all consecutive">
+      <option value="T">Tabs</option>
+      <option value="Sp">Spaces</option>
+      <option value="Dt">Dots</option>
+      <option value="C">Commas</option>
+      <option value="D">Dashes</option>
+      <option value="U">Underscores</option>
+      <option value="P">Pipes</option>
+    </param>
+    <param format="txt" name="input" type="data" label="in this Query"/>
+  </inputs>
+  <outputs>
+    <data format="input" name="out_file1" metadata_source="input" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="character" value="T"/>
+      <param name="input" value="1.bed"/>
+      <output name="out_file1" file="eq-condense.dat"/>
+    </test>
+  </tests>
+  <help>
+
+**What it does**
+
+This tool condenses all consecutive characters of a specified type.
+
+-----
+
+**Example**
+
+- Input file::
+
+    geneX,,,10,,,,,20
+    geneY,,5,,,,,12,15,9,
+
+- Condense all consecutive commas. The above file will be converted into::
+
+    geneX,10,20
+    geneY,5,12,15,9
+
+</help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/convert_characters.py
--- /dev/null
+++ b/tools/filters/convert_characters.py
@@ -0,0 +1,42 @@
+#!/usr/bin/env python
+#By, Guruprasad Ananda.
+
+from galaxy import eggs
+import sys, re
+
+def stop_err(msg):
+    sys.stderr.write(msg)
+    sys.exit()
+    
+def main():
+    if len(sys.argv) != 4:
+        stop_err("usage: convert_characters infile from_char outfile")
+
+    try:
+        fin = open(sys.argv[1],'r')
+    except:
+        stop_err("Input file cannot be opened for reading.")
+    
+    from_char = sys.argv[2]
+    
+    try:
+        fout = open(sys.argv[3],'w')
+    except:
+        stop_err("Output file cannot be opened for writing.")
+    
+    char_dict = {'T':'\t','s':'\s','Dt':'\.','C':',','D':'-','U':'_','P':'\|','Co':':'}
+    from_ch = char_dict[from_char] + '+'    #making an RE to match 1 or more occurences.
+    skipped = 0
+    
+    for line in fin:
+        line = line.strip()
+        try:
+            fout.write("%s\n" %(re.sub(from_ch,'\t',line)))     
+        except:
+            skipped += 1
+            
+    if skipped:
+        print "Skipped %d lines as invalid." %skipped
+    
+if __name__ == "__main__": 
+    main()
\ No newline at end of file


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/convert_characters.xml
--- /dev/null
+++ b/tools/filters/convert_characters.xml
@@ -0,0 +1,58 @@
+<tool id="Convert characters1" name="Convert">
+  <description>delimiters to TAB</description>
+  <command interpreter="python">convert_characters.py $input $convert_from $out_file1</command>
+  <inputs>
+    <param name="convert_from" type="select" label="Convert all">
+      <option value="s">Whitespaces</option>
+      <option value="T">Tabs</option>
+      <!--<option value="Sp">Spaces</option>-->
+      <option value="Dt">Dots</option>
+      <option value="C">Commas</option>
+      <option value="D">Dashes</option>
+      <option value="U">Underscores</option>
+      <option value="P">Pipes</option>
+      <option value="Co">Colons</option>
+    </param>
+    <param format="txt" name="input" type="data" label="in Query"/>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="convert_from" value="s"/>
+      <param name="input" value="1.bed"/>
+      <output name="out_file1" file="eq-convert.dat"/>
+    </test>
+    <test>
+      <param name="convert_from" value="s"/>
+      <param name="input" value="a.txt"/>
+      <output name="out_file1" file="a.tab"/>
+    </test>
+  </tests>
+  <help>
+
+**What it does**
+
+Converts all delimiters of a specified type into TABs.  Consecutive characters are condensed. For example, if columns are separated by 5 spaces they will converted into 1 tab.
+
+-----
+
+**Example**
+
+- Input file::
+
+    chrX||151283558|151283724|NM_000808_exon_8_0_chrX_151283559_r|0|-
+    chrX|151370273|151370486|NM_000808_exon_9_0_chrX_151370274_r|0|-
+    chrX|151559494|151559583|NM_018558_exon_1_0_chrX_151559495_f|0|+
+    chrX|151564643|151564711|NM_018558_exon_2_0_chrX_151564644_f||||0|+
+
+- Converting all pipe delimiters of the above file to TABs will get::
+
+    chrX  151283558  151283724  NM_000808_exon_8_0_chrX_151283559_r  0  -
+    chrX  151370273  151370486  NM_000808_exon_9_0_chrX_151370274_r  0  -
+    chrX  151559494  151559583  NM_018558_exon_1_0_chrX_151559495_f  0  +
+    chrX  151564643  151564711  NM_018558_exon_2_0_chrX_151564644_f  0  +
+
+</help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/cutWrapper.pl
--- /dev/null
+++ b/tools/filters/cutWrapper.pl
@@ -0,0 +1,77 @@
+#!/usr/bin/perl -w
+
+use strict;
+use warnings;
+
+my @columns = ();
+my $del = "";
+my @in = ();
+my @out = ();
+my $command = "";
+my $field = 0;
+
+# a wrapper for cut for use in galaxy
+# cutWrapper.pl [filename] [columns] [delim] [output]
+
+die "Check arguments\n" unless @ARGV == 4;
+
+$ARGV[1] =~ s/\s+//g;
+foreach ( split /,/, $ARGV[1] ) {
+  if (m/^c\d{1,}$/i) {
+    push (@columns, $_);
+    $columns[@columns-1] =~s/c//ig;
+  }
+}
+
+die "No columns specified, columns are not preceded with 'c', or commas are not used to separate column numbers: $ARGV[1]\n" if @columns == 0;
+
+my $column_delimiters_href = {
+  'T' => q{\t},
+  'C' => ",",
+  'D' => "-",
+  'U' => "_",
+  'P' => q{\|},
+  'Dt' => q{\.},
+  'Sp' => q{\s+}
+};
+
+$del = $column_delimiters_href->{$ARGV[2]};
+
+open (OUT, ">$ARGV[3]") or die "Cannot create $ARGV[2]:$!\n";
+open (IN,  "<$ARGV[0]") or die "Cannot open $ARGV[0]:$!\n";
+
+while (my $line=<IN>) {
+   if ($line =~ /^#/) {
+     #Ignore comment lines
+   } else {
+     chop($line);
+     @in = split(/$del/, $line);
+     foreach $field (@columns) {
+       if (defined($in[$field-1])) {
+         push(@out, $in[$field-1]);
+       } else {
+         push(@out, ".");
+       }
+     }    
+     print OUT join("\t",@out), "\n";
+     @out = ();
+   }
+}
+
+#while (<IN>) {
+#  chop;
+#  @in = split /$del/; 
+#  foreach $field (@columns) {
+#    if (defined($in[$field-1])) {
+#      push(@out, $in[$field-1]);
+#    } else {
+#      push(@out, ".");
+#    }
+#  }
+#  print OUT join("\t",@out), "\n";
+#  @out = ();
+#}
+close IN;
+
+close OUT;
+    


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/cutWrapper.xml
--- /dev/null
+++ b/tools/filters/cutWrapper.xml
@@ -0,0 +1,202 @@
+<tool id="Cut1" name="Cut" version="1.0.1">
+  <description>columns from a table</description>
+  <command interpreter="perl">cutWrapper.pl $input "$columnList" $delimiter $out_file1</command>
+  <inputs>
+    <param name="columnList" size="10" type="text" value="c1,c2" label="Cut columns"/>
+    <param name="delimiter" type="select" label="Delimited by">
+      <option value="T">Tab</option>
+      <option value="Sp">Whitespace</option>
+      <option value="Dt">Dot</option>
+      <option value="C">Comma</option>
+      <option value="D">Dash</option>
+      <option value="U">Underscore</option>
+      <option value="P">Pipe</option>
+    </param>
+    <param format="txt" name="input" type="data" label="From"/>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="out_file1" >
+      <actions>
+        <conditional name="delimiter">
+          <when value="T">
+            <conditional name="input">
+              <when datatype_isinstance="interval">
+                <action type="format" default="tabular">
+                  <option type="from_param" name="columnList" column="0" offset="0"><!-- chromCol is 1-->
+                    
+                    <filter type="insert_column" column="0" value="interval"/>
+                    
+                    <filter type="insert_column" ref="columnList" /><!-- startCol -->
+                    
+                    <filter type="insert_column" ref="columnList" /><!-- endCol -->
+                    
+                    <filter type="multiple_splitter" column="1" separator=","/>
+                    <filter type="column_strip" column="1"/><!-- get rid of all external whitespace -->
+                    <filter type="string_function" column="1" name="lower" />
+                    <filter type="param_value" column="1" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                    <filter type="column_strip" column="1" strip="c"/><!-- get rid of c's  -->
+                    <filter type="boolean" column="1" cast="int" />
+                    
+                    <filter type="multiple_splitter" column="2" separator=","/>
+                    <filter type="column_strip" column="2"/><!-- get rid of all external whitespace -->
+                    <filter type="string_function" column="2" name="lower" />
+                    <filter type="param_value" column="2" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                    <filter type="column_strip" column="2" strip="c"/><!-- get rid of c's  -->
+                    <filter type="boolean" column="2" cast="int" />
+                    
+                    <filter type="multiple_splitter" column="3" separator=","/>
+                    <filter type="column_strip" column="3"/><!-- get rid of all external whitespace -->
+                    <filter type="string_function" column="3" name="lower" />
+                    <filter type="param_value" column="3" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                    <filter type="column_strip" column="3" strip="c"/><!-- get rid of c's  -->
+                    <filter type="boolean" column="3" cast="int" />
+                    
+                    <filter type="metadata_value" ref="input" name="chromCol" column="1" />
+                    <filter type="metadata_value" ref="input" name="startCol" column="2" />
+                    <filter type="metadata_value" ref="input" name="endCol" column="3" />
+                    
+                  </option>
+                </action>
+                
+                <conditional name="out_file1">
+                  <when datatype_isinstance="interval">
+                    <action type="metadata" name="chromCol">
+                      <option type="from_param" name="columnList" column="0" offset="0"><!-- chromCol is 0-->
+                        <filter type="multiple_splitter" column="0" separator=","/>
+                        <filter type="column_strip" column="0"/><!-- get rid of all external whitespace -->
+                        <filter type="string_function" column="0" name="lower" />
+                        <filter type="param_value" column="0" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                        <filter type="column_strip" column="0" strip="c"/><!-- get rid of c's  -->
+                        <filter type="insert_column" value="1" iterate="True" column="0"/>
+                        <filter type="boolean" column="1" cast="int" /> 
+                        <filter type="metadata_value" ref="input" name="chromCol" column="1" />
+                      </option>
+                    </action>
+                    
+                    <action type="metadata" name="startCol">
+                      <option type="from_param" name="columnList" column="0" offset="0"><!-- startCol is 0-->
+                        <filter type="multiple_splitter" column="0" separator=","/>
+                        <filter type="column_strip" column="0"/><!-- get rid of all external whitespace -->
+                        <filter type="string_function" column="0" name="lower" />
+                        <filter type="param_value" column="0" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                        <filter type="column_strip" column="0" strip="c"/><!-- get rid of c's  -->
+                        <filter type="insert_column" value="1" iterate="True" column="0"/>
+                        <filter type="boolean" column="1" cast="int" />
+                        <filter type="metadata_value" ref="input" name="startCol" column="1" />
+                      </option>
+                    </action>
+                    
+                    <action type="metadata" name="endCol">
+                      <option type="from_param" name="columnList" column="0" offset="0"><!-- endCol is 0-->
+                        <filter type="multiple_splitter" column="0" separator=","/>
+                        <filter type="column_strip" column="0"/><!-- get rid of all external whitespace -->
+                        <filter type="string_function" column="0" name="lower" />
+                        <filter type="param_value" column="0" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                        <filter type="column_strip" column="0" strip="c"/><!-- get rid of c's  -->
+                        <filter type="insert_column" value="1" iterate="True" column="0"/>
+                        <filter type="boolean" column="1" cast="int" />
+                        <filter type="metadata_value" ref="input" name="endCol" column="1" />
+                      </option>
+                    </action>
+                  
+                    <action type="metadata" name="nameCol" default="0">
+                      <option type="from_param" name="columnList" column="0" offset="0"><!-- nameCol is 0-->
+                        <filter type="multiple_splitter" column="0" separator=","/>
+                        <filter type="column_strip" column="0"/><!-- get rid of all external whitespace -->
+                        <filter type="string_function" column="0" name="lower" />
+                        <filter type="param_value" column="0" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                        <filter type="column_strip" column="0" strip="c"/><!-- get rid of c's  -->
+                        <filter type="insert_column" value="1" iterate="True" column="0"/>
+                        <filter type="boolean" column="1" cast="int" />
+                        <filter type="metadata_value" ref="input" name="nameCol" column="1" />
+                      </option>
+                    </action>
+                  
+                    <action type="metadata" name="strandCol" default="0">
+                      <option type="from_param" name="columnList" column="0" offset="0"><!-- strandCol is 0-->
+                        <filter type="multiple_splitter" column="0" separator=","/>
+                        <filter type="column_strip" column="0"/><!-- get rid of all external whitespace -->
+                        <filter type="string_function" column="0" name="lower" />
+                        <filter type="param_value" column="0" value="^c\d{1,}$" compare="re_search" keep="True"/>
+                        <filter type="column_strip" column="0" strip="c"/><!-- get rid of c's  -->
+                        <filter type="insert_column" value="1" iterate="True" column="0"/>
+                        <filter type="boolean" column="1" cast="int" />
+                        <filter type="metadata_value" ref="input" name="strandCol" column="1" />
+                      </option>
+                    </action>  
+                  </when>
+                </conditional>
+                
+              </when>
+            </conditional>
+          </when>
+        </conditional>
+      </actions>
+    </data>
+  </outputs>
+  <tests>
+    <test>
+      <param name="columnList" value="c1,c4,c2,c3"/>
+      <param name="delimiter" value="T"/>
+      <param name="input" value="1.bed"/>
+      <output name="out_file1" file="eq-cut.dat"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+**WARNING: This tool breaks column assignments.** To re-establish column assignments run the tools and click on the pencil icon in the latest history item.
+
+.. class:: infomark
+
+The output of this tool is always in tabular format (e.g., if your original delimiters are commas, they will be replaced with tabs). For example:
+
+  Cutting columns 1 and 3 from::
+
+     apple,is,good
+     windows,is,bad
+
+  will give::
+
+    apple   good
+    windows bad
+
+-----
+
+**What it does**
+
+This tool selects (cuts out) specified columns from the dataset.
+
+- Columns are specified as **c1**, **c2**, and so on. Column count begins with **1**
+- Columns can be specified in any order (e.g., **c2,c1,c6**)
+- If you specify more columns than actually present - empty spaces will be filled with dots
+
+-----
+
+**Example**
+
+Input dataset (six columns: c1, c2, c3, c4, c5, and c6)::
+
+   chr1 10   1000  gene1 0 +
+   chr2 100  1500  gene2 0 +
+
+**cut** on columns "**c1,c4,c6**" will return::
+
+   chr1 gene1 +
+   chr2 gene2 +
+
+**cut** on columns "**c6,c5,c4,c1**" will return::
+
+   + 0 gene1 chr1 
+   + 0 gene2 chr2
+
+
+**cut** on columns "**c8,c7,c4**" will return::
+
+   . . gene1 
+   . . gene2
+   
+
+</help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/fixedValueColumn.pl
--- /dev/null
+++ b/tools/filters/fixedValueColumn.pl
@@ -0,0 +1,34 @@
+#! /usr/bin/perl -w
+
+use strict;
+use warnings;
+
+# fixedValueColumn.pl $input $out_file1 "expression" "iterate [yes|no]"
+
+my ($input, $out_file1, $expression, $iterate) = @ARGV;
+my $i = 0;
+my $numeric = 0;
+
+die "Check arguments\n" unless @ARGV == 4;
+
+open (DATA, "<$input") or die "Cannot open $input:$!\n";
+open (OUT,  ">$out_file1") or die "Cannot create $out_file1:$!\n";
+
+if ($expression =~ m/^\d+$/) {
+  $numeric = 1;
+  $i = $expression;
+}
+
+while (<DATA>) {
+  chop;
+  if ($iterate eq "no") {
+    print OUT "$_\t$expression\n";
+  } else {
+    print OUT "$_\t$i\n" if $numeric == 1;
+    print OUT "$_\t$expression-$i\n" if $numeric == 0;
+    ++$i;
+  }
+}
+
+close DATA;
+close OUT;


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/fixedValueColumn.xml
--- /dev/null
+++ b/tools/filters/fixedValueColumn.xml
@@ -0,0 +1,61 @@
+<tool id="addValue" name="Add column">
+  <description>to an existing dataset</description>
+  <command interpreter="perl">fixedValueColumn.pl $input $out_file1 "$exp" $iterate</command>
+  <inputs>
+     <param name="exp" size="20" type="text" value="1" label="Add this value"/>
+    <param format="tabular" name="input" type="data" label="to Dataset" help="Dataset missing? See TIP below" />
+    <param name="iterate" type="select" label="Iterate?">
+      <option value="no">NO</option>
+      <option value="yes">YES</option>
+    </param>    
+  </inputs>
+  <outputs>
+    <data format="input" name="out_file1" metadata_source="input"/>
+  </outputs>
+  <tests>
+    <test>
+      <param name="exp" value="1"/>
+      <param name="input" value="1.bed"/>
+      <param name="iterate" value="no"/>
+      <output name="out_file1" file="eq-addvalue.dat"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: infomark
+
+**TIP:** If your data is not TAB delimited, use *Text Manipulation->Convert*
+
+-----
+
+**What it does**
+
+You can enter any value and it will be added as a new column to your dataset
+
+-----
+
+**Example**
+
+If you original data looks like this::
+
+    chr1 10  100 geneA
+    chr2 200 300 geneB
+    chr2 400 500 geneC
+
+Typing **+** in the text box will generate::
+
+    chr1 10  100 geneA +
+    chr2 200 300 geneB +
+    chr2 400 500 geneC +
+     
+
+You can also add line numbers by selecting **Iterate: YES**. In this case if you enter **1** in the text box you will get::
+
+    chr1 10  100 geneA 1
+    chr2 200 300 geneB 2
+    chr2 400 500 geneC 3
+
+
+
+</help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/headWrapper.pl
--- /dev/null
+++ b/tools/filters/headWrapper.pl
@@ -0,0 +1,19 @@
+#! /usr/bin/perl -w
+
+use strict;
+use warnings;
+
+# a wrapper for head for use in galaxy
+# headWrapper.pl [filename] [# lines to show] [output]
+
+die "Check arguments" unless @ARGV == 3;
+die "Line number must be an integer\n" unless $ARGV[1]=~ m/^\d+$/;
+
+open (OUT, ">$ARGV[2]") or die "Cannot create $ARGV[2]:$!\n";
+open (HEAD, "head -n $ARGV[1] $ARGV[0]|") or die "Cannot run head:$!\n";
+while (<HEAD>) {
+    print OUT;
+}
+close OUT;
+close HEAD;
+    


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/headWrapper.xml
--- /dev/null
+++ b/tools/filters/headWrapper.xml
@@ -0,0 +1,42 @@
+<tool id="Show beginning1" name="Select first">
+  <description>lines from a dataset</description>
+  <command interpreter="perl">headWrapper.pl $input $lineNum $out_file1</command>
+  <inputs>
+    <param name="lineNum" size="5" type="integer" value="10" label="Select first" help="lines"/>
+    <param format="txt" name="input" type="data" label="from"/>
+  </inputs>
+  <outputs>
+    <data format="input" name="out_file1" metadata_source="input"/>
+  </outputs>
+  <tests>
+    <test>
+      <param name="lineNum" value="10"/>
+      <param name="input" value="1.bed"/>
+      <output name="out_file1" file="eq-showbeginning.dat"/>
+    </test>
+  </tests>
+  <help>
+
+**What it does**
+
+This tool outputs specified number of lines from the **beginning** of a dataset
+
+-----
+
+**Example**
+
+Selecting 2 lines from this::
+
+    chr7  56632  56652  D17003_CTCF_R6  310  +
+    chr7  56736  56756  D17003_CTCF_R7  354  +
+    chr7  56761  56781  D17003_CTCF_R4  220  +
+    chr7  56772  56792  D17003_CTCF_R7  372  +
+    chr7  56775  56795  D17003_CTCF_R4  207  +
+
+will produce::
+
+    chr7  56632  56652  D17003_CTCF_R6  310  +
+    chr7  56736  56756  D17003_CTCF_R7  354  +
+
+  </help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/mergeCols.py
--- /dev/null
+++ b/tools/filters/mergeCols.py
@@ -0,0 +1,37 @@
+import sys, re
+
+def stop_err( msg ):
+    sys.stderr.write( msg )
+    sys.exit()
+
+def __main__():
+    try:
+        infile =  open ( sys.argv[1], 'r')
+        outfile = open ( sys.argv[2], 'w')
+    except:
+        stop_err( 'Cannot open or create a file\n' )
+        
+    if len( sys.argv ) < 4:
+        stop_err( 'No columns to merge' )
+    else:
+        cols = sys.argv[3:]        
+
+    skipped_lines = 0
+
+    for line in infile:
+        line = line.rstrip( '\r\n' )
+        if line and not line.startswith( '#' ):
+            fields = line.split( '\t' )
+            line += '\t'
+            for col in cols:
+                try:
+                    line += fields[ int( col ) -1 ]
+                except:
+                    skipped_lines += 1
+                    
+            print >>outfile, line
+            
+    if skipped_lines > 0:
+        print 'Skipped %d invalid lines' % skipped_lines
+            
+if __name__ == "__main__" : __main__()
\ No newline at end of file


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/mergeCols.xml
--- /dev/null
+++ b/tools/filters/mergeCols.xml
@@ -0,0 +1,63 @@
+<tool id="mergeCols1" name="Merge Columns" version="1.0.1">
+  <description>together</description>
+  <command interpreter="python">
+   mergeCols.py 
+      $input1
+      $out_file1
+      $col1
+      $col2
+      #for $col in $columns
+        ${col.datacol}
+      #end for
+  </command>
+  <inputs>
+    <param format="tabular" name="input1" type="data" label="Select data" help="Dataset missing? See TIP below."/>
+    <param name="col1" label="Merge column" type="data_column" data_ref="input1" />
+    <param name="col2" label="with column" type="data_column" data_ref="input1" help="Need to add more columns? Use controls below."/>
+    <repeat name="columns" title="Columns">
+      <param name="datacol" label="Add column" type="data_column" data_ref="input1" />
+    </repeat>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="1.bed"/>
+      <param name="col1" value="4" />
+      <param name="col2" value="1" />
+      <param name="datacol" value="6" />
+      <output name="out_file1" file="mergeCols.dat"/>
+    </test>
+  </tests>
+<help>
+
+.. class:: infomark
+
+**TIP:** If your data is not TAB delimited, use *Text Manipulation->Convert*
+
+-----
+
+**What it does**
+
+This tool merges columns together. Any number of valid columns can be merged in any order.
+
+-----
+
+**Example**
+
+Input dataset (five columns: c1, c2, c3, c4, and c5)::
+
+   1 10   1000  gene1 chr
+   2 100  1500  gene2 chr
+
+merging columns "**c5,c1**" will return::
+
+   1 10   1000  gene1 chr chr1
+   2 100  1500  gene2 chr chr2
+
+.. class:: warningmark
+   
+Note that all original columns are preserved and the result of merge is added as the rightmost column.
+  </help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/remove_beginning.pl
--- /dev/null
+++ b/tools/filters/remove_beginning.pl
@@ -0,0 +1,33 @@
+#! /usr/bin/perl -w
+
+use strict;
+use warnings;
+
+# Removes the specified number of lines from the beginning of the file.
+# remove_beginning.pl [input] [num_lines] [output]
+
+die "Check arguments" unless @ARGV == 3;
+
+my $inputfile = $ARGV[0];
+my $num_lines = $ARGV[1];
+my $outputfile = $ARGV[2];
+
+my $curCount=0;
+
+my $fhIn;
+open ($fhIn, "< $inputfile") or die "Cannot open source file";
+
+my $fhOut;
+open ($fhOut, "> $outputfile");
+
+while (<$fhIn>)
+{
+    $curCount++;
+    if ($curCount<=$num_lines)
+    {
+        next;
+    }
+    print $fhOut $_;
+}
+close ($fhIn) or die "Cannot close source file";
+close ($fhOut) or die "Cannot close output file";


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/remove_beginning.xml
--- /dev/null
+++ b/tools/filters/remove_beginning.xml
@@ -0,0 +1,42 @@
+<tool id="Remove beginning1" name="Remove beginning">
+  <description>of a file</description>
+  <command interpreter="perl">remove_beginning.pl $input $num_lines $out_file1</command>
+  <inputs>
+    <param name="num_lines" size="5" type="integer" value="1" label="Remove first" help="lines"/>
+    <param format="txt" name="input" type="data" label="from"/>
+  </inputs>
+  <outputs>
+    <data format="input" name="out_file1" metadata_source="input"/>
+  </outputs>
+  <tests>
+    <test>
+      <param name="num_lines" value="5"/>
+      <param name="input" value="1.bed"/>
+      <output name="out_file1" file="eq-removebeginning.dat"/>
+    </test>
+  </tests>
+  <help>
+
+**What it does**
+
+This tool removes a specified number of lines from the beginning of a dataset.
+
+-----
+
+**Example**
+
+Input File::
+
+    chr7  56632  56652   D17003_CTCF_R6  310  +
+    chr7  56736  56756   D17003_CTCF_R7  354  +
+    chr7  56761  56781   D17003_CTCF_R4  220  +
+    chr7  56772  56792   D17003_CTCF_R7  372  +
+    chr7  56775  56795   D17003_CTCF_R4  207  +
+
+After removing the first 3 lines the dataset will look like this::
+
+    chr7  56772  56792   D17003_CTCF_R7  372  +
+    chr7  56775  56795   D17003_CTCF_R4  207  +
+
+</help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/tailWrapper.pl
--- /dev/null
+++ b/tools/filters/tailWrapper.pl
@@ -0,0 +1,19 @@
+#! /usr/bin/perl -w
+
+use strict;
+use warnings;
+
+# a wrapper for tail for use in galaxy
+# lessWrapper.pl [filename] [# lines to show] [output]
+
+die "Check arguments" unless @ARGV == 3;
+die "Line number should be an integer\n" unless $ARGV[1]=~ m/^\d+$/;
+
+open (OUT, ">$ARGV[2]") or die "Cannot create $ARGV[2]:$!\n";
+open (TAIL, "tail -n $ARGV[1] $ARGV[0]|") or die "Cannot run tail:$!\n";
+while (<TAIL>) {
+    print OUT;
+}
+close OUT;
+close TAIL;
+    


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/tailWrapper.xml
--- /dev/null
+++ b/tools/filters/tailWrapper.xml
@@ -0,0 +1,42 @@
+<tool id="Show tail1" name="Select last">
+  <description>lines from a dataset</description>
+  <command interpreter="perl">tailWrapper.pl $input $lineNum $out_file1</command>
+  <inputs>
+    <param name="lineNum" size="5" type="integer" value="10" label="Select last" help="lines"/>
+    <param format="txt" name="input" type="data" label="from"/>
+  </inputs>
+  <outputs>
+    <data format="input" name="out_file1" metadata_source="input"/>
+  </outputs>
+  <tests>
+    <test>
+      <param name="lineNum" value="10"/>
+      <param name="input" value="1.bed"/>
+      <output name="out_file1" file="eq-showtail.dat"/>
+    </test>
+  </tests>
+  <help>
+
+**What it does**
+
+This tool outputs specified number of lines from the **end** of a dataset
+
+-----
+
+**Example**
+
+- Input File::
+
+    chr7    57134   57154   D17003_CTCF_R7  356     -
+    chr7    57247   57267   D17003_CTCF_R4  207     +
+    chr7    57314   57334   D17003_CTCF_R5  269     +
+    chr7    57341   57361   D17003_CTCF_R7  375     +
+    chr7    57457   57477   D17003_CTCF_R3  188     +
+
+- Show last two lines of above file. The result is::
+
+    chr7    57341   57361   D17003_CTCF_R7  375     +
+    chr7    57457   57477   D17003_CTCF_R3  188     +
+
+  </help>
+</tool>


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/trimmer.py
--- /dev/null
+++ b/tools/filters/trimmer.py
@@ -0,0 +1,106 @@
+#!/usr/bin/env python
+
+import sys
+import optparse
+
+def stop_err( msg ):
+    sys.stderr.write( msg )
+    sys.exit()
+
+def main():
+    usage = """%prog [options]
+    
+options (listed below) default to 'None' if omitted
+    """
+    parser = optparse.OptionParser(usage=usage)
+    
+    parser.add_option(
+        '-a','--ascii',
+        dest='ascii',
+        action='store_true',
+        default = False,
+        help='Use ascii codes to defined ignored beginnings instead of raw characters')
+        
+    parser.add_option(
+        '-q','--fastq',
+        dest='fastq',
+        action='store_true',
+        default = False,
+        help='The input data in fastq format. It selected the script skips every even line since they contain sequence ids')
+
+    parser.add_option(
+        '-i','--ignore',
+        dest='ignore',
+        help='A comma separated list on ignored beginnings (e.g., ">,@"), or its ascii codes (e.g., "60,42") if option -a is enabled')
+
+    parser.add_option(
+        '-s','--start',
+        dest='start',
+        default = '0',
+        help='Trim from beginning to here (1-based)')
+
+    parser.add_option(
+        '-e','--end',
+        dest='end',
+        default = '0',
+        help='Trim from here to the ned (1-based)')
+
+    parser.add_option(
+        '-f','--file',
+        dest='input_txt',
+        default = False,
+        help='Name of file to be chopped. STDIN is default')
+            
+    parser.add_option(
+        '-c','--column',
+        dest='col',
+        default = '0',
+        help='Column to chop. If 0 = chop the whole line')
+       
+
+    options, args = parser.parse_args()
+    invalid_starts = []
+
+    if options.input_txt:
+		infile = open ( options.input_txt, 'r')
+    else:
+    	infile = sys.stdin
+    	
+    if options.ignore and options.ignore != "None":
+        invalid_starts = options.ignore.split(',')
+        
+    if options.ascii and options.ignore and options.ignore != "None":
+        for i, item in enumerate( invalid_starts ):
+            invalid_starts[i] = chr( int( item ) )
+
+    col = int( options.col )
+ 
+    for i, line in enumerate( infile ):
+        line = line.rstrip( '\r\n' )
+        if line:
+            
+            if options.fastq and i % 2 == 0:
+                print line
+                continue
+                
+
+            if line[0] not in invalid_starts:
+                if col == 0:
+                    if int( options.end ) > 0:
+                        line = line[ int( options.start )-1 : int( options.end ) ]
+                    else:
+                        line = line[ int( options.start )-1 : ]
+                else:
+                    fields = line.split( '\t' )
+                    if col-1 > len( fields ):
+                        stop_err('Column %d does not exist. Check input parameters\n' % col)
+                        
+                    if int( options.end ) > 0:
+                        fields[col - 1] = fields[col - 1][ int( options.start )-1 : int( options.end ) ]
+                    else:
+                        fields[col - 1] = fields[col - 1][ int( options.start )-1 : ]
+                    line = '\t'.join(fields)
+            print line   
+
+if __name__ == "__main__": main()
+


diff -r 2f45da781f926f667dd90ad23d23fd123716a535 -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 tools/filters/trimmer.xml
--- /dev/null
+++ b/tools/filters/trimmer.xml
@@ -0,0 +1,120 @@
+<tool id="trimmer" name="Trim" version="0.0.1">
+    <description>leading or trailing characters</description>
+    <command interpreter="python">
+    trimmer.py -a -f $input1 -c $col -s $start -e $end -i $ignore $fastq > $out_file1
+    </command>
+    <inputs>
+        <param format="tabular,txt" name="input1" type="data" label="this dataset"/>
+        <param name="col" type="integer" value="0" label="Trim this column only" help="0 = process entire line" />
+        <param name="start" type="integer" size="10" value="1" label="Trim from the beginning to this position" help="1 = do not trim the beginning"/>
+        <param name="end" type="integer" size="10" value="0" label="Remove everything from this position to the end" help="0 = do not trim the end"/>
+        <param name="fastq" type="select" label="Is input dataset in fastq format?" help="If set to YES, the tool will not trim evenly numbered lines (0, 2, 4, etc...)">
+            <option selected="true" value="">No</option>
+            <option value="-q">Yes</option>
+        </param>
+        <param name="ignore" type="select" display="checkboxes" multiple="True" label="Ignore lines beginning with these characters" help="lines beginning with these are not trimmed">
+            <option value="62">></option>
+            <option value="64">@</option>
+            <option value="43">+</option>
+            <option value="60"><</option>
+            <option value="42">*</option>
+            <option value="45">-</option>
+            <option value="61">=</option>
+            <option value="124">|</option>
+            <option value="63">?</option>
+            <option value="36">$</option>
+            <option value="46">.</option>
+            <option value="58">:</option>
+            <option value="38">&</option>
+            <option value="37">%</option>
+            <option value="94">^</option>
+            <option value="35">#</option>
+         </param>   
+    </inputs>
+    <outputs>
+        <data name="out_file1" format="input" metadata_source="input1"/>
+    </outputs>
+    <tests>
+        <test>
+           <param name="input1" value="trimmer_tab_delimited.dat"/>
+           <param name="col" value="0"/>
+           <param name="start" value="1"/>
+           <param name="end" value="13"/>
+           <param name="ignore" value="62"/>
+           <param name="fastq" value="No"/>
+           <output name="out_file1" file="trimmer_a_f_c0_s1_e13_i62.dat"/>
+        </test>
+        <test>
+           <param name="input1" value="trimmer_tab_delimited.dat"/>
+           <param name="col" value="2"/>
+           <param name="start" value="1"/>
+           <param name="end" value="2"/>
+           <param name="ignore" value="62"/>
+           <param name="fastq" value="No"/>
+           <output name="out_file1" file="trimmer_a_f_c2_s1_e2_i62.dat"/>
+        </test>
+
+    </tests>
+
+    <help>
+
+
+**What it does**
+
+Trims specified number of characters from a dataset or its field (if dataset is tab-delimited).
+
+-----
+
+**Example 1**
+
+Trimming this dataset::
+
+  1234567890
+  abcdefghijk
+
+by setting **Trim from the beginning to this position** to *2* and **Remove everything from this position to the end** to *6* will produce::
+
+  23456
+  bcdef
+
+-----
+
+**Example 2**
+
+Trimming column 2 of this dataset::
+
+  abcde 12345 fghij 67890
+  fghij 67890 abcde 12345
+
+by setting **Trim content of this column only** to *2*, **Trim from the beginning to this position** to *2*, and **Remove everything from this position to the end** to *4* will produce::
+
+  abcde  234 fghij 67890
+  fghij  789 abcde 12345
+
+-----
+
+**Trimming FASTQ datasets**
+
+This tool can be used to trim sequences and quality strings in fastq datasets. This is done by selected *Yes* from the **Is input dataset in fastq format?** dropdown. If set to *Yes*, the tool will skip all even numbered lines (see warning below). For example, trimming last 5 bases of this dataset::
+
+  @081017-and-081020:1:1:1715:1759
+  GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC
+  +
+  II#IIIIIII$5+.(9IIIIIII$%*$G$A31I&&B
+  
+cab done by setting **Remove everything from this position to the end** to 31::
+
+  @081017-and-081020:1:1:1715:1759
+  GGACTCAGATAGTAATCCACGCTCCTTTAAA
+  +
+  II#IIIIIII$5+.(9IIIIIII$%*$G$A3 
+  
+**Note** that headers are skipped.
+
+.. class:: warningmark
+
+**WARNING:** This tool will only work on properly formatted fastq datasets where (1) each read and quality string occupy one line and (2) '@' (read header) and "+" (quality header) lines are evenly numbered like in the above example.
+
+
+    </help>
+</tool>



https://bitbucket.org/galaxy/galaxy-central/changeset/facdd387b85e/
changeset:   facdd387b85e
user:        inithello
date:        2012-12-07 22:39:17
summary:     Updated tool_conf.xml.main with reverted migration.
affected #:  1 file

diff -r 659392eae2a8946ea6d2f2c5534d5c51c1dc28f3 -r facdd387b85e814df7428ca8cbb71828d0ec48a2 tool_conf.xml.main
--- a/tool_conf.xml.main
+++ b/tool_conf.xml.main
@@ -33,11 +33,21 @@
     <tool file="extract/liftOver_wrapper.xml" /></section><section name="Text Manipulation" id="textutil">
+    <tool file="filters/fixedValueColumn.xml" /><tool file="stats/column_maker.xml" /><tool file="filters/catWrapper.xml" />
+    <tool file="filters/condense_characters.xml" />
+    <tool file="filters/convert_characters.xml" />
+    <tool file="filters/mergeCols.xml" /><tool file="filters/CreateInterval.xml" />
+    <tool file="filters/cutWrapper.xml" />
+    <tool file="filters/changeCase.xml" /><tool file="filters/pasteWrapper.xml" />
+    <tool file="filters/remove_beginning.xml" /><tool file="filters/randomlines.xml" />
+    <tool file="filters/headWrapper.xml" />
+    <tool file="filters/tailWrapper.xml" />
+    <tool file="filters/trimmer.xml" /><tool file="filters/wc_gnu.xml" /><tool file="filters/secure_hash_message_digest.xml" /></section>

Repository URL: https://bitbucket.org/galaxy/galaxy-central/

--

This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.

    

Bitbucket

tags

participants (1)