1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/bae2efef9ac7/
changeset: r5602:bae2efef9ac7
user: richard_burhans
date: 2011-05-26 19:29:00
summary: updated help section for the genome diversity extract primers tool
affected #: 1 file (153 bytes)
--- a/tools/genome_diversity/extract_primers.xml Thu May 26 08:27:52 2011 -0400
+++ b/tools/genome_diversity/extract_primers.xml Thu May 26 13:29:00 2011 -0400
@@ -49,7 +49,16 @@
<help>
**What it does**
- It extracts primers for the SNPs in the dataset.
+ This tool extracts primers for SNPs in the argument dataset using the
+ Primer3 program. The first line of output for a given SNP reports the
+ name of the assembled contig, the SNP's position in the contig, the
+ two variant nucleotides, and Primer3's "pair penalty". The next line,
+ if not blank, names restriction enzymes (from the user-adjustable list)
+ that differentially cut at that site, but do not cut at any other position
+ between and including the primer positions. The next lines show the SNP's
+ flanking regions, with the SNP position indicated by "n", including the
+ primer positions and an additional 3 nucleotides.
+
-----
@@ -57,30 +66,26 @@
- input file::
- chr2_75111355_75112576 314 A C L F chr2 75111676 C F 15 4 53 2 9
48 Y 96 0.369 0.355 0.396 0
- chr8_93901796_93905612 2471 A C A A chr8 93904264 A A 8 0 51 10 2
14 Y 961 0.016 0.534 0.114 2
- chr10_7434473_7435447 524 T C S S chr10 7435005 T S 11 5 90 14 0
69 Y 626 0.066 0.406 0.727 0
- chr14_80021455_80022064 138 G A H H chr14 80021593 G H 14 0 69 9 6
124 Y 377 0.118 0.997 0.195 1
- chr15_64470252_64471048 89 G A Y Y chr15 64470341 G Y 5 6 109 14 0
69 Y 312 0.247 0.998 0.393 0
- chr18_48070585_48071386 514 C T E K chr18 48071100 T K 7 7 46 14 0
69 Y 2 0.200 0.032 0.163 0
- chr18_50154905_50155664 304 A G Y C chr18 50155208 A Y 4 2 17 5 1
22 Y 8 0.022 0.996 0.128 0
- chr18_57379354_57380496 315 C T V V chr18 57379669 G V 11 0 60 9 6
62 Y 726 0.118 0.048 0.014 1
- chr19_14240610_14242055 232 C T A V chr19 14240840 C A 18 8 56 15 5
42 Y 73 0.003 0.153 0.835 0
- chr19_39866997_39874915 3117 C T P P chr19 39870110 C P 3 7 65 14 2
32 Y 6 0.321 0.911 0.462 4
- etc.
+ chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y
496 0.502 0.033 0.215 6
+ chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y
22 0.502 0.025 2.365 1
+ chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y
190 0.512 0.880 2.733 4
+ chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y
169 0.554 0.024 0.366 4
- output file::
- > chr2_75111355_75112576 314 A C 0.613831
+ chr5_30800874_30802049 734 G A 0.352964
+ BglII,MboI,Sau3AI,Tru9I,XhoII
+ 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA
+
>>>>>>>>>>>>>>>>>>>>
- 1 TTTGCCCTGAGGCAGACTTTTTAAAGTACTGTGTAATGTATGAAGTCCTTCTGCTCAAGC
-
>>>>>>>>>>>>>>>>>>>>
-
- 61 AAATCATTGGCATGAAAACAGTTGCAAACTTATTGTGAGAGAAGAGTCCAAGAGTTTTAA
-
-
- 121 CAGTCTGTAAGTATATAGCCTGTGAGTTTGATTTCCTTCTTGTTTTTnTTCCAGAAACAT
-
+ 61 AGTCTAACAACTCGCCCTCTGCTTAnATCTGAGACTCACAGGGATAATAACACACTTGGT
+
+
+ 21 CAAGGAATAAACTAGATATTATTCACTCCTCTAGAAGGCTGCCAGGAAAATTGCCTGACT
+
<<<<<<<
+
+ 181 TGAACCTTGGCTCTGA
+
<<<<<<<<<<<<<
etc.
</help></tool>
Repository URL:
https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from
bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.