1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/314d41df7881/ changeset: 314d41df7881 user: dan date: 2011-09-08 16:34:56 summary: Minor tool help updates. affected #: 8 files (1.6 KB) --- a/tools/fastx_toolkit/fasta_clipping_histogram.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml Thu Sep 08 10:34:56 2011 -0400 @@ -99,6 +99,12 @@ Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts. +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool><!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> --- a/tools/fastx_toolkit/fasta_formatter.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_formatter.xml Thu Sep 08 10:34:56 2011 -0400 @@ -76,5 +76,12 @@ AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fasta_nucleotide_changer.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_nucleotide_changer.xml Thu Sep 08 10:34:56 2011 -0400 @@ -62,5 +62,12 @@ >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 TGGAATGTAAAGAAGTATGTA + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_barcode_splitter.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml Thu Sep 08 10:34:56 2011 -0400 @@ -64,6 +64,13 @@ .. image:: ./static/fastx_icons/barcode_splitter_output_example.png + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool><!-- FASTX-barcode-splitter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> --- a/tools/fastx_toolkit/fastx_clipper.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_clipper.xml Thu Sep 08 10:34:56 2011 -0400 @@ -104,6 +104,12 @@ - + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_collapser.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_collapser.xml Thu Sep 08 10:34:56 2011 -0400 @@ -77,5 +77,12 @@ means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/plotting/boxplot.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/plotting/boxplot.xml Thu Sep 08 10:34:56 2011 -0400 @@ -97,6 +97,12 @@ .. image:: ./static/images/solid_qual.png +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + </help></tool> --- a/tools/visualization/GMAJ.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/visualization/GMAJ.xml Thu Sep 08 10:34:56 2011 -0400 @@ -194,6 +194,16 @@ For detailed information on GMAJ, click here_. + +------ + +**Citation** + +If you use GMAJ, please cite `Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. <http://www.ncbi.nlm.nih.gov/pubmed/15060014>`_ and http://globin.cse.psu.edu/dist/gmaj/. + +If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + .. _here: /static/gmaj/docs/gmaj_readme.html .. _TBA: http://www.bx.psu.edu/miller_lab/ </help> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.