[galaxy-dev] [hg] galaxy 2670: Automated merge with http://bitbucket.org/gala...

9 Sep 2009

details:   http://www.bx.psu.edu/hg/galaxy/rev/c3b40f23a0e0
changeset: 2670:c3b40f23a0e0
user:      James Taylor <james@jamestaylor.org>
date:      Wed Sep 09 14:24:11 2009 -0400
description:
Automated merge with http://bitbucket.org/galaxy/galaxy-central/

2 file(s) affected in this change:

lib/galaxy/model/__init__.py
templates/dataset/edit_attributes.mako

diffs (truncated from 7595 to 3000 lines):

diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_fasta_converter.py

--- a/lib/galaxy/datatypes/converters/maf_to_fasta_converter.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/datatypes/converters/maf_to_fasta_converter.py	Wed Sep 09 14:24:11 2009 -0400
@@ -14,12 +14,15 @@
     input_name = sys.argv.pop(1)
     out = open( output_name, 'w' )
     count = 0
-    for count, maf in enumerate( bx.align.maf.Reader( open( input_name, 'r' ) ) ):
-        for c in maf.components:
-            spec, chrom = bx.align.maf.src_split( c.src )
-            if not spec or not chrom:
-                    spec = chrom = c.src
-            out.write( "%s\n" % maf_utilities.get_fasta_header( c, suffix = "%s_%i" % ( spec, count ) ) )
+    for count, block in enumerate( bx.align.maf.Reader( open( input_name, 'r' ) ) ):
+        spec_counts = {}
+        for c in block.components:
+            spec, chrom = maf_utilities.src_split( c.src )
+            if spec not in spec_counts:
+                spec_counts[ spec ] = 0
+            else:
+                spec_counts[ spec ] += 1
+            out.write( "%s\n" % maf_utilities.get_fasta_header( c, { 'block_index' : count, 'species' : spec, 'sequence_index' : spec_counts[ spec ] }, suffix = "%s_%i_%i" % ( spec, count, spec_counts[ spec ] ) ) )
             out.write( "%s\n" % c.text )
         out.write( "\n" )
     out.close()
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_fasta_converter.xml
--- a/lib/galaxy/datatypes/converters/maf_to_fasta_converter.xml	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/datatypes/converters/maf_to_fasta_converter.xml	Wed Sep 09 14:24:11 2009 -0400
@@ -1,4 +1,4 @@
-<tool id="CONVERTER_maf_to_fasta_0" name="Convert MAF to Fasta">
+<tool id="CONVERTER_maf_to_fasta_0" name="Convert MAF to Fasta" version="1.0.1">
 <!--  <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> -->
   <command interpreter="python">maf_to_fasta_converter.py $output1 $input1</command>
   <inputs>
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_interval_converter.py
--- a/lib/galaxy/datatypes/converters/maf_to_interval_converter.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/datatypes/converters/maf_to_interval_converter.py	Wed Sep 09 14:24:11 2009 -0400
@@ -4,7 +4,8 @@
 import sys
 from galaxy import eggs
 import pkg_resources; pkg_resources.require( "bx-python" )
-import bx.align.maf
+import bx.align.maf
+from galaxy.tools.util import maf_utilities
 
 assert sys.version_info[:2] >= ( 2, 4 )
 
@@ -17,15 +18,15 @@
     #write interval header line
     out.write( "#chrom\tstart\tend\tstrand\n" )
     try:
-        for maf in bx.align.maf.Reader( open(input_name, 'r') ):
-            c = maf.get_component_by_src_start(species)
-            if c is not None:
-                out.write( "%s\t%i\t%i\t%s\n" % (bx.align.src_split(c.src)[-1], c.get_forward_strand_start(), c.get_forward_strand_end(), c.strand) )
-                count += 1
+        for block in bx.align.maf.Reader( open( input_name, 'r' ) ):
+            for c in maf_utilities.iter_components_by_src_start( block, species ):
+                if c is not None:
+                    out.write( "%s\t%i\t%i\t%s\n" %  ( bx.align.src_split( c.src )[-1], c.get_forward_strand_start(), c.get_forward_strand_end(), c.strand ) )
+                    count += 1
     except Exception, e:
         print >> sys.stderr, "There was a problem processing your input: %s" % e
     out.close()
-    print "%i MAF blocks converted to Genomic Intervals for species %s." % (count, species)
+    print "%i MAF blocks converted to Genomic Intervals for species %s." % ( count, species )
 
 
 if __name__ == "__main__": __main__()
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_interval_converter.xml
--- a/lib/galaxy/datatypes/converters/maf_to_interval_converter.xml	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/datatypes/converters/maf_to_interval_converter.xml	Wed Sep 09 14:24:11 2009 -0400
@@ -1,4 +1,4 @@
-<tool id="CONVERTER_maf_to_interval_0" name="Convert MAF to Genomic Intervals">
+<tool id="CONVERTER_maf_to_interval_0" name="Convert MAF to Genomic Intervals" version="1.0.1">
 <!--  <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> -->
   <command interpreter="python">maf_to_interval_converter.py $output1 $input1 ${input1.metadata.dbkey}</command>
   <inputs>
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/sequence.py
--- a/lib/galaxy/datatypes/sequence.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/datatypes/sequence.py	Wed Sep 09 14:24:11 2009 -0400
@@ -22,7 +22,7 @@
         pass
 
 class Alignment( Sequence ):
-    """Class describing an alignmnet"""
+    """Class describing an alignment"""
 
     """Add metadata elements"""
     MetadataElement( name="species", desc="Species", default=[], param=metadata.SelectParameter, multiple=True, readonly=True, no_value=None )
@@ -316,6 +316,78 @@
     import bx.align.maf
 except:
     pass
+#trying to import maf_utilities here throws an ImportError due to a circular import between jobs and tools:
+#from galaxy.tools.util.maf_utilities import build_maf_index_species_chromosomes
+#Traceback (most recent call last):
+#  File "./scripts/paster.py", line 27, in <module>
+#    command.run()
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/script/command.py", line 78, in run
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/script/command.py", line 117, in invoke
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/script/command.py", line 212, in run
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/script/serve.py", line 227, in command
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/script/serve.py", line 250, in loadapp
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 193, in loadapp
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 213, in loadobj
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 237, in loadcontext
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 267, in _loadconfig
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 397, in get_context
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 439, in _context_from_explicit
+#  File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 18, in import_string
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/pkg_resources.py", line 1912, in load
+#    entry = __import__(self.module_name, globals(),globals(), ['__name__'])
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/web/buildapp.py", line 18, in <module>
+#    from galaxy import config, jobs, util, tools
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/jobs/__init__.py", line 3, in <module>
+#    from galaxy import util, model
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/model/__init__.py", line 13, in <module>
+#    import galaxy.datatypes.registry
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/datatypes/registry.py", line 6, in <module>
+#    import data, tabular, interval, images, sequence, qualityscore, genetics, xml, coverage, tracks, chrominfo
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/datatypes/sequence.py", line 344, in <module>
+#    from galaxy.tools.util.maf_utilities import build_maf_index_species_chromosomes
+#  File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/tools/__init__.py", line 15, in <module>
+#    from galaxy import util, jobs, model
+#ImportError: cannot import name jobs
+#so we'll copy and paste for now...terribly icky
+#*** ANYCHANGE TO THIS METHOD HERE OR IN maf_utilities MUST BE PROPAGATED ***
+def COPIED_build_maf_index_species_chromosomes( filename, index_species = None ):
+    species = []
+    species_chromosomes = {}
+    indexes = bx.interval_index_file.Indexes()
+    try:
+        maf_reader = bx.align.maf.Reader( open( filename ) )
+        while True:
+            pos = maf_reader.file.tell()
+            block = maf_reader.next()
+            if block is None: break
+            for c in block.components:
+                spec = c.src
+                chrom = None
+                if "." in spec:
+                    spec, chrom = spec.split( ".", 1 )
+                if spec not in species: 
+                    species.append( spec )
+                    species_chromosomes[spec] = []
+                if chrom and chrom not in species_chromosomes[spec]:
+                    species_chromosomes[spec].append( chrom )
+                if index_species is None or spec in index_species:
+                    forward_strand_start = c.forward_strand_start
+                    forward_strand_end = c.forward_strand_end
+                    try:
+                        forward_strand_start = int( forward_strand_start )
+                        forward_strand_end = int( forward_strand_end )
+                    except ValueError:
+                        continue #start and end are not integers, can't add component to index, goto next component
+                        #this likely only occurs when parse_e_rows is True?
+                        #could a species exist as only e rows? should the
+                    if forward_strand_end > forward_strand_start:
+                        #require positive length; i.e. certain lines have start = end = 0 and cannot be indexed
+                        indexes.add( c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size )
+    except Exception, e:
+        #most likely a bad MAF
+        log.debug( 'Building MAF index on %s failed: %s' % ( filename, e ) )
+        return ( None, [], {} )
+    return ( indexes, species, species_chromosomes )
 
 class Maf( Alignment ):
     """Class describing a Maf alignment"""
@@ -333,38 +405,8 @@
         Parses and sets species, chromosomes, index from MAF file.
         """
         #these metadata values are not accessable by users, always overwrite
+        indexes, species, species_chromosomes = COPIED_build_maf_index_species_chromosomes( dataset.file_name )
         
-        try:
-            maf_reader = bx.align.maf.Reader( open( dataset.file_name ) )
-        except:
-            return #not a maf file
-        species = []
-        species_chromosomes = {}
-        indexes = bx.interval_index_file.Indexes()
-        while True:
-            pos = maf_reader.file.tell()
-            block = maf_reader.next()
-            if block is None: break
-            for c in block.components:
-                spec = c.src
-                chrom = None
-                if "." in spec:
-                    spec, chrom = spec.split( ".", 1 )
-                if spec not in species: 
-                    species.append(spec)
-                    species_chromosomes[spec] = []
-                if chrom and chrom not in species_chromosomes[spec]:
-                    species_chromosomes[spec].append( chrom )
-                forward_strand_start = c.forward_strand_start
-                forward_strand_end = c.forward_strand_end
-                try:
-                    forward_strand_start = int( forward_strand_start )
-                    forward_strand_end = int( forward_strand_end )
-                except ValueError:
-                    continue #start and end are not integers, can't add component to index, goto next component
-                if forward_strand_end > forward_strand_start:
-                    #require positive length; i.e. certain lines have start = end = 0 and cannot be indexed
-                    indexes.add( c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size )
         dataset.metadata.species = species
         #only overwrite the contents if our newly determined chromosomes don't match stored
         chrom_file = dataset.metadata.species_chromosomes
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/model/__init__.py
--- a/lib/galaxy/model/__init__.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/model/__init__.py	Wed Sep 09 14:24:11 2009 -0400
@@ -709,9 +709,9 @@
         folder.order_id = self.item_count
         self.item_count += 1
     def get_info_association( self, restrict=False ):
-        # If restrict is True, we will return this folder's info_association whether it
-        # exists or not.  If restrict is False, we'll return the next available info_association
-        # in the inheritable hierarchy
+        # If restrict is True, we will return this folder's info_association, not inheriting.
+        # If restrict is False, we'll return the next available info_association in the
+        # inheritable hierarchy
         if self.info_association:
             return self.info_association[0]
         if restrict:
@@ -721,9 +721,6 @@
         if self.library_root:
             return self.library_root[0].get_info_association()
         return None
-    @property
-    def active_components( self ):
-        return list( self.active_folders ) + list( self.active_library_datasets )
     @property
     def active_library_datasets( self ):
          # This needs to be a list
@@ -736,10 +733,6 @@
     def active_datasets( self ):
          # This needs to be a list
         return [ ld.library_dataset_dataset_association.dataset for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ]
-    @property #make this a relation
-    def activatable_folders( self ):
-        # This needs to be a list
-        return [ folder for folder in self.folders if not folder.purged ]
 
 class LibraryDataset( object ):
     # This class acts as a proxy to the currently selected LDDA
@@ -1062,17 +1055,11 @@
                 return s
         return False
     def submitted(self):
-        if self.state == self.states.SUBMITTED:
-            return True
-        return False
+        return self.state == self.states.SUBMITTED
     def unsubmitted(self):
-        if self.state == self.states.UNSUBMITTED:
-            return True
-        return False
+        return self.state == self.states.UNSUBMITTED
     def complete(self):
-        if self.state == self.states.COMPLETE:
-            return True
-        return False
+        return self.state == self.states.COMPLETE
         
 class RequestType( object ):
     def __init__(self, name=None, desc=None, request_form=None, sample_form=None):
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/model/mapping.py
--- a/lib/galaxy/model/mapping.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/model/mapping.py	Wed Sep 09 14:24:11 2009 -0400
@@ -233,10 +233,10 @@
     Column( "id", Integer, primary_key=True ),
     Column( "library_dataset_dataset_association_id", Integer, ForeignKey( "library_dataset_dataset_association.id", use_alter=True, name="library_dataset_dataset_association_id_fk" ), nullable=True, index=True ),#current version of dataset, if null, there is not a current version selected
     Column( "folder_id", Integer, ForeignKey( "library_folder.id" ), index=True ),
-    Column( "order_id", Integer ),
+    Column( "order_id", Integer ), #not currently being used, but for possible future use
     Column( "create_time", DateTime, default=now ),
     Column( "update_time", DateTime, default=now, onupdate=now ),
-    Column( "name", TrimmedString( 255 ), key="_name" ), #when not None/null this will supercede display in library (but not when imported into user's history?)
+    Column( "name", TrimmedString( 255 ), key="_name", index=True ), #when not None/null this will supercede display in library (but not when imported into user's history?)
     Column( "info", TrimmedString( 255 ),  key="_info" ), #when not None/null this will supercede display in library (but not when imported into user's history?)
     Column( "deleted", Boolean, index=True, default=False ) )
 
@@ -248,7 +248,7 @@
     Column( "update_time", DateTime, default=now, onupdate=now ),
     Column( "copied_from_history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id", use_alter=True, name='history_dataset_association_dataset_id_fkey' ), nullable=True ),
     Column( "copied_from_library_dataset_dataset_association_id", Integer, ForeignKey( "library_dataset_dataset_association.id", use_alter=True, name='library_dataset_dataset_association_id_fkey' ), nullable=True ),
-    Column( "name", TrimmedString( 255 ) ),
+    Column( "name", TrimmedString( 255 ), index=True ),
     Column( "info", TrimmedString( 255 ) ),
     Column( "blurb", TrimmedString( 255 ) ),
     Column( "peek" , TEXT ),
@@ -276,9 +276,9 @@
     Column( "parent_id", Integer, ForeignKey( "library_folder.id" ), nullable = True, index=True ),
     Column( "create_time", DateTime, default=now ),
     Column( "update_time", DateTime, default=now, onupdate=now ),
-    Column( "name", TEXT ),
+    Column( "name", TEXT, index=True ),
     Column( "description", TEXT ),
-    Column( "order_id", Integer ),
+    Column( "order_id", Integer ), #not currently being used, but for possible future use
     Column( "item_count", Integer ),
     Column( "deleted", Boolean, index=True, default=False ),
     Column( "purged", Boolean, index=True, default=False ),
@@ -823,15 +823,16 @@
         folders=relation( 
             LibraryFolder, 
             primaryjoin=( LibraryFolder.table.c.parent_id == LibraryFolder.table.c.id ),
+            order_by=asc( LibraryFolder.table.c.name ),
             backref=backref( "parent", primaryjoin=( LibraryFolder.table.c.parent_id == LibraryFolder.table.c.id ), remote_side=[LibraryFolder.table.c.id] ) ),
         active_folders=relation( LibraryFolder, 
             primaryjoin=( ( LibraryFolder.table.c.parent_id == LibraryFolder.table.c.id ) & ( not_( LibraryFolder.table.c.deleted ) ) ), 
-            order_by=asc( LibraryFolder.table.c.order_id ), 
+            order_by=asc( LibraryFolder.table.c.name ), 
             lazy=True, #"""sqlalchemy.exceptions.ArgumentError: Error creating eager relationship 'active_folders' on parent class '<class 'galaxy.model.LibraryFolder'>' to child class '<class 'galaxy.model.LibraryFolder'>': Cant use eager loading on a self referential relationship."""
             viewonly=True ),
         datasets=relation( LibraryDataset,
             primaryjoin=( ( LibraryDataset.table.c.folder_id == LibraryFolder.table.c.id ) ), 
-            order_by=asc( LibraryDataset.table.c.order_id ), 
+            order_by=asc( LibraryDataset.table.c._name ), 
             lazy=False, 
             viewonly=True )
     ) )
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/model/migrate/versions/0017_library_item_indexes.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/model/migrate/versions/0017_library_item_indexes.py	Wed Sep 09 14:24:11 2009 -0400
@@ -0,0 +1,53 @@
+"""
+This script adds 3 indexes to table columns: library_folder.name,
+library_dataset.name, library_dataset_dataset_association.name.
+"""
+from sqlalchemy import *
+from sqlalchemy.orm import *
+from migrate import *
+import sys, logging
+
+log = logging.getLogger( __name__ )
+log.setLevel(logging.DEBUG)
+handler = logging.StreamHandler( sys.stdout )
+format = "%(name)s %(levelname)s %(asctime)s %(message)s"
+formatter = logging.Formatter( format )
+handler.setFormatter( formatter )
+log.addHandler( handler )
+
+metadata = MetaData( migrate_engine )
+db_session = scoped_session( sessionmaker( bind=migrate_engine, autoflush=False, transactional=False ) )
+LibraryFolder_table = Table( "library_folder", metadata, autoload=True )
+LibraryDatasetDatasetAssociation_table = Table( "library_dataset_dataset_association", metadata, autoload=True )
+LibraryDataset_table = Table( "library_dataset", metadata, autoload=True )
+          
+def display_migration_details():
+    print "========================================"
+    print "This script adds 3 indexes to table columns: library_folder.name,"
+    print "library_dataset.name, library_dataset_dataset_association.name."
+    print "========================================"
+        
+def upgrade():
+    display_migration_details()
+    # Load existing tables
+    metadata.reflect()
+    # Add 1 index to the library_folder table
+    i = Index( 'ix_library_folder_name', LibraryFolder_table.c.name )
+    try:
+        i.create()
+    except Exception, e:
+        log.debug( "Adding index 'ix_library_folder_name' to library_folder table failed: %s" % ( str( e ) ) )
+    # Add 1 index to the library_dataset_dataset_association table
+    i = Index( 'ix_library_dataset_dataset_association_name', LibraryDatasetDatasetAssociation_table.c.name )
+    try:
+        i.create()
+    except Exception, e:
+        log.debug( "Adding index 'ix_library_dataset_dataset_association_name' to library_dataset_dataset_association table failed: %s" % ( str( e ) ) )
+    # Add 1 index to the library_dataset table
+    i = Index( 'ix_library_dataset_name', LibraryDataset_table.c.name )
+    try:
+        i.create()
+    except Exception, e:
+        log.debug( "Adding index 'ix_library_dataset_name' to library_dataset table failed: %s" % ( str( e ) ) )
+def downgrade():
+    log.debug( "Downgrade is not possible." )
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/security/__init__.py
--- a/lib/galaxy/security/__init__.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/security/__init__.py	Wed Sep 09 14:24:11 2009 -0400
@@ -33,11 +33,19 @@
     def get_actions( self ):
         """Get all permitted actions as a list of Action objects"""
         return self.permitted_actions.__dict__.values()
-    def allow_action( self, user, roles, action, **kwd ):
-        raise 'No valid method of checking action (%s) on %s for user %s.' % ( action, kwd, user )
     def get_item_action( self, action, item ):
         raise 'No valid method of retrieving action (%s) for item %s.' % ( action, item )
     def guess_derived_permissions_for_datasets( self, datasets = [] ):
+        raise "Unimplemented Method"
+    def can_access_dataset( self, roles, dataset ):
+        raise "Unimplemented Method"
+    def can_manage_dataset( self, roles, dataset ):
+        raise "Unimplemented Method"
+    def can_add_library_item( self, user, roles, item ):
+        raise "Unimplemented Method"
+    def can_modify_library_item( self, user, roles, item ):
+        raise "Unimplemented Method"
+    def can_manage_library_item( self, user, roles, item ):
         raise "Unimplemented Method"
     def associate_components( self, **kwd ):
         raise 'No valid method of associating provided components: %s' % kwd
@@ -89,62 +97,44 @@
         to allow migration toward a more SQLAlchemy 0.4 style of use.
         """
         return self.model.context.current
-    def allow_action( self, user, roles, action, **kwd ):
-        if 'dataset' in kwd:
-            return self.allow_dataset_action( user, roles, action, kwd[ 'dataset' ] )
-        elif 'library_item' in kwd:
-            return self.allow_library_item_action( user, roles, action, kwd[ 'library_item' ] )
-        raise 'No valid method of checking action (%s) for user %s using kwd %s' % ( action, str( user ), str( kwd ) )
-    def allow_dataset_action( self, user, roles, action, dataset ):
-        """Returns true when user has permission to perform an action"""
-        if not user:
-            if action == self.permitted_actions.DATASET_ACCESS and action.action not in [ dp.action for dp in dataset.actions ]:
-                # anons only get access, and only if there are no roles required for the access action
-                # Other actions (or if the dataset has roles defined for the access action) fall through
-                # to the false below
-                return True
-        elif action.action not in [ dp.action for dp in dataset.actions ]:
-            if action.model == 'restrict':
-                # Implicit access to restrict-style actions if the dataset does not have the action
-                # Grant style actions fall through to the false below
-                return True
-        else:
-            perms = self.get_dataset_permissions( dataset )
-            if action in perms.keys():
-                # The filter() returns a list of the dataset's role ids of which the user is not a member,
-                # so an empty list means the user has all of the required roles.
-                if not filter( lambda x: x not in roles, [ r for r in perms[ action ] ] ):
-                    # User has all of the roles required to perform the action
-                    return True
-        # The user is missing at least one required role
-        return False
-    def allow_library_item_action( self, user, roles, action, library_item ):
+    def allow_dataset_action( self, roles, action, dataset ):
+        """
+        Returns true when user has permission to perform an action on an
+        instance of Dataset.
+        """
+        dataset_action = self.get_item_action( action, dataset )
+        if dataset_action is None:
+            return action.model == 'restrict'
+        return dataset_action.role in roles
+    def can_access_dataset( self, roles, dataset ):
+        return self.allow_dataset_action( roles, self.permitted_actions.DATASET_ACCESS, dataset )
+    def can_manage_dataset( self, roles, dataset ):
+        return self.allow_dataset_action( roles, self.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset )
+    def allow_library_item_action( self, user, roles, action, item ):
+        """
+        Method for checking a permission for the current user to perform a
+        specific library action on a library item, which must be one of:
+        Library, LibraryFolder, LibraryDataset, LibraryDatasetDatasetAssociation
+        """
         if user is None:
             # All permissions are granted, so non-users cannot have permissions
             return False
-        if action.model == 'grant':
-            # Check to see if user has access to any of the roles
-            allowed_role_assocs = []
-            for item_class, permission_class in self.library_item_assocs:
-                if isinstance( library_item, item_class ):
-                    if permission_class == self.model.LibraryPermissions:
-                        allowed_role_assocs = permission_class.filter_by( action=action.action, library_id=library_item.id ).all()
-                    elif permission_class == self.model.LibraryFolderPermissions:
-                        allowed_role_assocs = permission_class.filter_by( action=action.action, library_folder_id=library_item.id ).all()
-                    elif permission_class == self.model.LibraryDatasetPermissions:
-                        allowed_role_assocs = permission_class.filter_by( action=action.action, library_dataset_id=library_item.id ).all()
-                    elif permission_class == self.model.LibraryDatasetDatasetAssociationPermissions:
-                        allowed_role_assocs = permission_class.filter_by( action=action.action, library_dataset_dataset_association_id=library_item.id ).all()
-            for allowed_role_assoc in allowed_role_assocs:
-                if allowed_role_assoc.role in roles:
-                    return True
+        # Check to see if user has access to any of the roles associated with action
+        item_action = self.get_item_action( action, item )
+        if item_action is None:
+            # All permissions are granted, so item must have action
             return False
-        else:
-            raise 'Unimplemented model (%s) specified for action (%s)' % ( action.model, action.action )
+        return item_action.role in roles
+    def can_add_library_item( self, user, roles, item ):
+        return self.allow_library_item_action( user, roles, self.permitted_actions.LIBRARY_ADD, item )
+    def can_modify_library_item( self, user, roles, item ):
+        return self.allow_library_item_action( user, roles, self.permitted_actions.LIBRARY_MODIFY, item )
+    def can_manage_library_item( self, user, roles, item ):
+        return self.allow_library_item_action( user, roles, self.permitted_actions.LIBRARY_MANAGE, item )
     def get_item_action( self, action, item ):
         # item must be one of: Dataset, Library, LibraryFolder, LibraryDataset, LibraryDatasetDatasetAssociation
         for permission in item.actions:
-            if permission.action == action:
+            if permission.action == action.action:
                 return permission
         return None
     def guess_derived_permissions_for_datasets( self, datasets=[] ):
@@ -276,10 +266,7 @@
                 if [ assoc for assoc in dataset.history_associations if assoc.history not in user.histories ]:
                     # Don't change permissions on a dataset associated with a history not owned by the user
                     continue
-                if bypass_manage_permission or self.allow_action( user,
-                                                                  user.all_roles(),
-                                                                  self.permitted_actions.DATASET_MANAGE_PERMISSIONS,
-                                                                  dataset=dataset ):
+                if bypass_manage_permission or self.can_manage_dataset( user.all_roles(), dataset ):
                     self.set_all_dataset_permissions( dataset, permissions )
     def history_get_default_permissions( self, history ):
         permissions = {}
@@ -291,7 +278,10 @@
                 permissions[ action ] = [ dhp.role ]
         return permissions
     def set_all_dataset_permissions( self, dataset, permissions={} ):
-        # Set new permissions on a dataset, eliminating all current permissions        
+        """
+        Set new permissions on a dataset, eliminating all current permissions
+        permissions looks like: { Action : [ Role, Role ] }
+        """
         # Delete all of the current permissions on the dataset
         # TODO: If setting ACCESS permission, at least 1 user must have every role associated with this dataset,
         # or the dataset is inaccessible.  See admin/library_dataset_dataset_association()
@@ -305,7 +295,10 @@
             for dp in [ self.model.DatasetPermissions( action, dataset, role ) for role in roles ]:
                 dp.flush()
     def set_dataset_permission( self, dataset, permission={} ):
-        # Set a specific permission on a dataset, leaving all other current permissions on the dataset alone
+        """
+        Set a specific permission on a dataset, leaving all other current permissions on the dataset alone
+        permissions looks like: { Action : [ Role, Role ] }
+        """
         # TODO: If setting ACCESS permission, at least 1 user must have every role associated with this dataset,
         # or the dataset is inaccessible.  See admin/library_dataset_dataset_association()
         for action, roles in permission.items():
@@ -331,8 +324,11 @@
                 dp.delete()
                 dp.flush()
     def get_dataset_permissions( self, dataset ):
-        if not isinstance( dataset, self.model.Dataset ):
-            dataset = dataset.dataset
+        """
+        Return a dictionary containing the actions and associated roles on dataset.
+        The dictionary looks like: { Action : [ Role, Role ] }
+        dataset must be an instance of Dataset()
+         """
         permissions = {}
         for dp in dataset.actions:
             action = self.get_action( dp.action )
@@ -423,18 +419,29 @@
             else:
                 raise 'Invalid class (%s) specified for target_library_item (%s)' % \
                     ( target_library_item.__class__, target_library_item.__class__.__name__ )
-    def show_library_item( self, user, roles, library_item ):
-        if self.allow_action( user, roles, self.permitted_actions.LIBRARY_MODIFY, library_item=library_item ) or \
-            self.allow_action( user, roles, self.permitted_actions.LIBRARY_MANAGE, library_item=library_item ) or \
-            self.allow_action( user, roles, self.permitted_actions.LIBRARY_ADD, library_item=library_item ):
-            return True
+    def show_library_item( self, user, roles, library_item, actions_to_check, hidden_folder_ids='' ):
+        """
+        This method must be sent an instance of Library() or LibraryFolder().  Recursive execution produces a
+        comma-separated string of folder ids whose folders do NOT meet the criteria for showing. Along with
+        the string, True is returned if the current user has permission to perform any 1 of actions_to_check
+        on library_item. Otherwise, cycle through all sub-folders in library_item until one is found that meets
+        this criteria, if it exists.
+        """        
+        for action in actions_to_check:
+            if self.allow_library_item_action( user, roles, action, library_item ):
+                return True, hidden_folder_ids
         if isinstance( library_item, self.model.Library ):
-            return self.show_library_item( user, roles, library_item.root_folder )
-        elif isinstance( library_item, self.model.LibraryFolder ):
-            for folder in library_item.folders:
-                if self.show_library_item( user, roles, folder ):
-                    return True
-        return False
+            return self.show_library_item( user, roles, library_item.root_folder, actions_to_check, hidden_folder_ids=hidden_folder_ids )
+        if isinstance( library_item, self.model.LibraryFolder ):
+            for folder in library_item.active_folders:
+                can_show, hidden_folder_ids = self.show_library_item( user, roles, folder, actions_to_check, hidden_folder_ids=hidden_folder_ids )
+                if can_show:
+                    return True, hidden_folder_ids
+                if hidden_folder_ids:
+                    hidden_folder_ids = '%s,%d' % ( hidden_folder_ids, folder.id )
+                else:
+                    hidden_folder_ids = '%d' % folder.id
+        return False, hidden_folder_ids
     def set_entity_user_associations( self, users=[], roles=[], groups=[], delete_existing_assocs=True ):
         for user in users:
             if delete_existing_assocs:
@@ -482,12 +489,14 @@
             if 'role' in kwd:
                 return self.model.GroupRoleAssociation.filter_by( role_id = kwd['role'].id, group_id = kwd['group'].id ).first()
         raise 'No valid method of associating provided components: %s' % kwd
-    def check_folder_contents( self, user, roles, folder ):
+    def check_folder_contents( self, user, roles, folder, hidden_folder_ids='' ):
         """
-        Return true if there are any datasets under 'folder' that are public or that the
-        user has access permission on.
+        This method must always be sent an instance of LibraryFolder().  Recursive execution produces a
+        comma-separated string of folder ids whose folders do NOT meet the criteria for showing.  Along
+        with the string, True is returned if the current user has permission to access folder. Otherwise,
+        cycle through all sub-folders in folder until one is found that meets this criteria, if it exists.
         """
-        action = self.permitted_actions.DATASET_ACCESS.action
+        action = self.permitted_actions.DATASET_ACCESS
         lddas = self.sa_session.query( self.model.LibraryDatasetDatasetAssociation ) \
             .join( "library_dataset" ) \
             .filter( self.model.LibraryDataset.folder == folder ) \
@@ -498,14 +507,19 @@
             ldda_access = self.get_item_action( action, ldda.dataset )
             if ldda_access is None:
                 # Dataset is public
-                return True
+                return True, hidden_folder_ids
             if ldda_access.role in roles:
                 # The current user has access permission on the dataset
-                return True
+                return True, hidden_folder_ids
         for sub_folder in folder.active_folders:
-            if self.check_folder_contents( user, roles, sub_folder ):
-                return True
-        return False
+            can_access, hidden_folder_ids = self.check_folder_contents( user, roles, sub_folder, hidden_folder_ids=hidden_folder_ids )
+            if can_access:
+                return True, hidden_folder_ids
+            if hidden_folder_ids:
+                hidden_folder_ids = '%s,%d' % ( hidden_folder_ids, sub_folder.id )
+            else:
+                hidden_folder_ids = '%d' % sub_folder.id
+        return False, hidden_folder_ids
 
 class HostAgent( RBACAgent ):
     """
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/tools/actions/__init__.py
--- a/lib/galaxy/tools/actions/__init__.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/tools/actions/__init__.py	Wed Sep 09 14:24:11 2009 -0400
@@ -48,10 +48,7 @@
                             assoc.flush()
                             data = new_data
                 user, roles = trans.get_user_and_roles()
-                if data and not trans.app.security_agent.allow_action( user,
-                                                                       roles,
-                                                                       data.permitted_actions.DATASET_ACCESS,
-                                                                       dataset=data.dataset ):
+                if data and not trans.app.security_agent.can_access_dataset( roles, data.dataset ):
                     raise "User does not have permission to use a dataset (%s) provided for input." % data.id
                 return data
             if isinstance( input, DataToolParameter ):
@@ -267,10 +264,7 @@
         user, roles = trans.get_user_and_roles()
         for name, dataset in inp_data.iteritems():
             if dataset:
-                if not trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              dataset.permitted_actions.DATASET_ACCESS,
-                                                              dataset=dataset.dataset ):
+                if not trans.app.security_agent.can_access_dataset( roles, dataset.dataset ):
                     raise "User does not have permission to use a dataset (%s) provided for input." % data.id
                 job.add_input_dataset( name, dataset )
             else:
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/tools/parameters/basic.py
--- a/lib/galaxy/tools/parameters/basic.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/tools/parameters/basic.py	Wed Sep 09 14:24:11 2009 -0400
@@ -1149,19 +1149,11 @@
                     hid = str( hda.hid )
                 if not hda.dataset.state in [galaxy.model.Dataset.states.ERROR, galaxy.model.Dataset.states.DISCARDED] and \
                     hda.visible and \
-                    trans.app.security_agent.allow_action( user,
-                                                           roles,
-                                                           hda.permitted_actions.DATASET_ACCESS,
-                                                           dataset=hda.dataset ):
+                    trans.app.security_agent.can_access_dataset( roles, hda.dataset ):
                     # If we are sending data to an external application, then we need to make sure there are no roles
-                    # associated with the dataset that restrict it's access from "public".  We determine this by sending
-                    # None as the user to the allow_action method.
-                    if self.tool and self.tool.tool_type == 'data_destination':
-                        if not trans.app.security_agent.allow_action( None,
-                                                                      None,
-                                                                      hda.permitted_actions.DATASET_ACCESS,
-                                                                      dataset=hda.dataset ):
-                            continue
+                    # associated with the dataset that restrict it's access from "public".
+                    if self.tool and self.tool.tool_type == 'data_destination' and not trans.app.security_agent.dataset_is_public( hda.dataset ):
+                        continue
                     if self.options and hda.get_dbkey() != filter_value:
                         continue
                     if isinstance( hda.datatype, self.formats):
@@ -1172,10 +1164,7 @@
                         if target_ext:
                             if converted_dataset:
                                 hda = converted_dataset
-                            if not trans.app.security_agent.allow_action( user,
-                                                                          roles,
-                                                                          trans.app.security_agent.permitted_actions.DATASET_ACCESS,
-                                                                          dataset=hda.dataset ):
+                            if not trans.app.security_agent.can_access_dataset( roles, hda.dataset ):
                                 continue
                             selected = ( value and ( hda in value ) )
                             field.add_option( "%s: (as %s) %s" % ( hid, target_ext, hda_name ), hda.id, selected )
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/tools/util/maf_utilities.py
--- a/lib/galaxy/tools/util/maf_utilities.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/tools/util/maf_utilities.py	Wed Sep 09 14:24:11 2009 -0400
@@ -7,10 +7,41 @@
 import bx.align.maf
 import bx.intervals
 import bx.interval_index_file
-import sys, os, string, tempfile
+import sys, os, string, tempfile
+import logging
+from copy import deepcopy
 
 assert sys.version_info[:2] >= ( 2, 4 )
-
+
+log = logging.getLogger(__name__)
+
+
+GAP_CHARS = [ '-' ]
+SRC_SPLIT_CHAR = '.'
+
+def src_split( src ):
+    spec, chrom = bx.align.maf.src_split( src )
+    if None in [ spec, chrom ]:
+        spec = chrom = src
+    return spec, chrom
+
+def src_merge( spec, chrom, contig = None ):
+    if None in [ spec, chrom ]:
+        spec = chrom = spec or chrom
+    return bx.align.maf.src_merge( spec, chrom, contig )
+
+def get_species_in_block( block ):
+    species = []
+    for c in block.components:
+        spec, chrom = src_split( c.src )
+        if spec not in species:
+            species.append( spec )
+    return species
+
+def tool_fail( msg = "Unknown Error" ):
+    print >> sys.stderr, "Fatal Error: %s" % msg
+    sys.exit()
+
 #an object corresponding to a reference layered alignment
 class RegionAlignment( object ):
     
@@ -153,69 +184,187 @@
     except:
         return build_maf_index( maf_file, species = species )
     
+#*** ANYCHANGE TO THIS METHOD HERE OR IN galaxy.datatypes.sequences MUST BE PROPAGATED ***
+def build_maf_index_species_chromosomes( filename, index_species = None ):
+    species = []
+    species_chromosomes = {}
+    indexes = bx.interval_index_file.Indexes()
+    try:
+        maf_reader = bx.align.maf.Reader( open( filename ) )
+        while True:
+            pos = maf_reader.file.tell()
+            block = maf_reader.next()
+            if block is None: break
+            for c in block.components:
+                spec = c.src
+                chrom = None
+                if "." in spec:
+                    spec, chrom = spec.split( ".", 1 )
+                if spec not in species: 
+                    species.append( spec )
+                    species_chromosomes[spec] = []
+                if chrom and chrom not in species_chromosomes[spec]:
+                    species_chromosomes[spec].append( chrom )
+                if index_species is None or spec in index_species:
+                    forward_strand_start = c.forward_strand_start
+                    forward_strand_end = c.forward_strand_end
+                    try:
+                        forward_strand_start = int( forward_strand_start )
+                        forward_strand_end = int( forward_strand_end )
+                    except ValueError:
+                        continue #start and end are not integers, can't add component to index, goto next component
+                        #this likely only occurs when parse_e_rows is True?
+                        #could a species exist as only e rows? should the
+                    if forward_strand_end > forward_strand_start:
+                        #require positive length; i.e. certain lines have start = end = 0 and cannot be indexed
+                        indexes.add( c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size )
+    except Exception, e:
+        #most likely a bad MAF
+        log.debug( 'Building MAF index on %s failed: %s' % ( filename, e ) )
+        return ( None, [], {} )
+    return ( indexes, species, species_chromosomes )
 
 #builds and returns ( index, index_filename ) for specified maf_file
 def build_maf_index( maf_file, species = None ):
-    indexes = bx.interval_index_file.Indexes()
-    try:
-        maf_reader = bx.align.maf.Reader( open( maf_file ) )
-        # Need to be a bit tricky in our iteration here to get the 'tells' right
-        while True:
-            pos = maf_reader.file.tell()
-            block = maf_reader.next()
-            if block is None: break
-            for c in block.components:
-                if species is not None and c.src.split( "." )[0] not in species:
-                    continue
-                indexes.add( c.src, c.forward_strand_start, c.forward_strand_end, pos )
+    indexes, found_species, species_chromosomes = build_maf_index_species_chromosomes( maf_file, species )
+    if indexes is not None:
         fd, index_filename = tempfile.mkstemp()
         out = os.fdopen( fd, 'w' )
         indexes.write( out )
         out.close()
-        return ( bx.align.maf.Indexed( maf_file, index_filename = index_filename, keep_open = True, parse_e_rows = False ), index_filename )
-    except:
-        return ( None, None )
-
-def chop_block_by_region( block, src, region, species = None, mincols = 0, force_strand = None ):
-    ref = block.get_component_by_src( src )
-    #We want our block coordinates to be from positive strand
-    if ref.strand == "-":
-        block = block.reverse_complement()
-        ref = block.get_component_by_src( src )
+        return ( bx.align.maf.Indexed( maf_file, index_filename = index_filename, keep_open = True, parse_e_rows = False ), index_filename )
+    return ( None, None )
+
+def component_overlaps_region( c, region ):
+    if c is None: return False
+    start, end = c.get_forward_strand_start(), c.get_forward_strand_end()
+    if region.start >= end or region.end <= start:
+        return False
+    return True
+
+def chop_block_by_region( block, src, region, species = None, mincols = 0 ):
+    # This chopping method was designed to maintain consistency with how start/end padding gaps have been working in Galaxy thus far:
+    #   behavior as seen when forcing blocks to be '+' relative to src sequence (ref) and using block.slice_by_component( ref, slice_start, slice_end )
+    #   whether-or-not this is the 'correct' behavior is questionable, but this will at least maintain consistency
+    # comments welcome
+    slice_start = block.text_size #max for the min()
+    slice_end = 0 #min for the max()
+    old_score = block.score #save old score for later use
+    # We no longer assume only one occurance of src per block, so we need to check them all
+    for c in iter_components_by_src( block, src ):
+        if component_overlaps_region( c, region ):
+            if c.text is not None:
+                rev_strand = False
+                if c.strand == "-":
+                    #We want our coord_to_col coordinates to be returned from positive stranded component
+                    rev_strand = True
+                    c = c.reverse_complement()
+                start = max( region.start, c.start )
+                end = min( region.end, c.end )
+                start = c.coord_to_col( start )
+                end = c.coord_to_col( end )
+                if rev_strand:
+                    #need to orient slice coordinates to the original block direction
+                    slice_len = end - start
+                    end = len( c.text ) - start
+                    start = end - slice_len
+                slice_start = min( start, slice_start )
+                slice_end = max( end, slice_end )
+    
+    if slice_start < slice_end:
+        block = block.slice( slice_start, slice_end )
+        if block.text_size > mincols:
+            # restore old score, may not be accurate, but it is better than 0 for everything?
+            block.score = old_score
+            if species is not None:
+                block = block.limit_to_species( species )
+                block.remove_all_gap_columns()
+            return block
+    return None
     
-    #save old score here for later use
-    old_score =  block.score
-    slice_start = max( region.start, ref.start )
-    slice_end = min( region.end, ref.end )
-    
-    #slice block by reference species at determined limits
-    block = block.slice_by_component( ref, slice_start, slice_end )
-    
-    if block.text_size > mincols:
-        if ( force_strand is None and region.strand != ref.strand ) or ( force_strand is not None and force_strand != ref.strand ):
-            block = block.reverse_complement()
-        # restore old score, may not be accurate, but it is better than 0 for everything
-        block.score = old_score
-        if species is not None:
-            block = block.limit_to_species( species )
-            block.remove_all_gap_columns()
-        return block
-    return None
+def orient_block_by_region( block, src, region, force_strand = None ):
+    #loop through components matching src,
+    #make sure each of these components overlap region
+    #cache strand for each of overlaping regions
+    #if force_strand / region.strand not in strand cache, reverse complement
+    ### we could have 2 sequences with same src, overlapping region, on different strands, this would cause no reverse_complementing
+    strands = [ c.strand for c in iter_components_by_src( block, src ) if component_overlaps_region( c, region ) ]
+    if strands and ( force_strand is None and region.strand not in strands ) or ( force_strand is not None and force_strand not in strands ):
+        block = block.reverse_complement()
+    return block
+
+def get_oriented_chopped_blocks_for_region( index, src, region, species = None, mincols = 0, force_strand = None ):
+    for block, idx, offset in get_oriented_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols, force_strand ):
+        yield block
+def get_oriented_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0, force_strand = None ):
+    for block, idx, offset in get_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols ):
+        yield orient_block_by_region( block, src, region, force_strand ), idx, offset
+
+#split a block with multiple occurances of src into one block per src
+def iter_blocks_split_by_src( block, src ):
+    for src_c in iter_components_by_src( block, src ):
+        new_block = bx.align.Alignment( score=block.score, attributes=deepcopy( block.attributes ) )
+        new_block.text_size = block.text_size
+        for c in block.components:
+            if c == src_c or c.src != src:
+                new_block.add_component( deepcopy( c ) ) #components have reference to alignment, dont want to loose reference to original alignment block in original components
+        yield new_block
+
+#split a block into multiple blocks with all combinations of a species appearing only once per block
+def iter_blocks_split_by_species( block, species = None ):
+    def __split_components_by_species( components_by_species, new_block ):
+        if components_by_species:
+            #more species with components to add to this block
+            components_by_species = deepcopy( components_by_species )
+            spec_comps = components_by_species.pop( 0 )
+            for c in spec_comps:
+                newer_block = deepcopy( new_block )
+                newer_block.add_component( deepcopy( c ) )
+                for value in __split_components_by_species( components_by_species, newer_block ):
+                    yield value
+        else:
+            #no more components to add, yield this block
+            yield new_block
+    
+    #divide components by species    
+    spec_dict = {}
+    if not species:
+        species = []
+        for c in block.components:
+            spec, chrom = src_split( c.src )
+            if spec not in spec_dict:
+                spec_dict[ spec ] = []
+                species.append( spec )
+            spec_dict[ spec ].append( c )
+    else:
+        for spec in species:
+            spec_dict[ spec ] = []
+            for c in iter_components_by_src_start( block, spec ):
+                spec_dict[ spec ].append( c )
+    
+    empty_block = bx.align.Alignment( score=block.score, attributes=deepcopy( block.attributes ) ) #should we copy attributes?
+    empty_block.text_size = block.text_size
+    #call recursive function to split into each combo of spec/blocks
+    for value in __split_components_by_species( spec_dict.values(), empty_block ):
+        sort_block_components_by_block( value, block ) #restore original component order
+        yield value
+
+
 #generator yielding only chopped and valid blocks for a specified region
-def get_chopped_blocks_for_region( index, src, region, species = None, mincols = 0, force_strand = None ):
-    for block, idx, offset in get_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols, force_strand ):
+def get_chopped_blocks_for_region( index, src, region, species = None, mincols = 0 ):
+    for block, idx, offset in get_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols ):
         yield block
-def get_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0, force_strand = None ):
+def get_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0 ):
     for block, idx, offset in index.get_as_iterator_with_index_and_offset( src, region.start, region.end ):
-        block = chop_block_by_region( block, src, region, species, mincols, force_strand )
+        block = chop_block_by_region( block, src, region, species, mincols )
         if block is not None:
             yield block, idx, offset
 
 #returns a filled region alignment for specified regions
-def get_region_alignment( index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0 ):
+def get_region_alignment( index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0, overwrite_with_gaps = True ):
     if species is not None: alignment = RegionAlignment( end - start, species )
     else: alignment = RegionAlignment( end - start, primary_species )
-    return fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand, species, mincols )
+    return fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand, species, mincols, overwrite_with_gaps )
 
 #reduces a block to only positions exisiting in the src provided
 def reduce_block_by_primary_genome( block, species, chromosome, region_start ):
@@ -237,13 +386,11 @@
     return ( start_offset, species_texts )
 
 #fills a region alignment 
-def fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0 ):
+def fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0, overwrite_with_gaps = True ):
     region = bx.intervals.Interval( start, end )
     region.chrom = chrom
     region.strand = strand
     primary_src = "%s.%s" % ( primary_species, chrom )
-    
-
     
     #Order blocks overlaping this position by score, lowest first
     blocks = []
@@ -255,28 +402,40 @@
                 break
         else:
             blocks.append( ( score, idx, offset ) )
-    
+    
+    gap_chars_tuple = tuple( GAP_CHARS )
+    gap_chars_str = ''.join( GAP_CHARS )
     #Loop through ordered blocks and layer by increasing score
-    for block_dict in blocks:
-        block = chop_block_by_region( block_dict[1].get_at_offset( block_dict[2] ), primary_src, region, species, mincols, strand )
-        if block is None: continue
-        start_offset, species_texts = reduce_block_by_primary_genome( block, primary_species, chrom, start )
-        for spec, text in species_texts.items():
-            try:
-                alignment.set_range( start_offset, spec, text )
-            except:
-                #species/sequence for species does not exist
-                pass
-    
+    for block_dict in blocks:
        for block in iter_blocks_split_by_species( block_dict[1].get_at_offset( block_dict[2] ) ): #need to handle each occurance of sequence in block seperately
+            if component_overlaps_region( block.get_component_by_src( primary_src ), region ):
+                block = chop_block_by_region( block, primary_src, region, species, mincols ) #chop block
+                block = orient_block_by_region( block, primary_src, region ) #orient block
+                start_offset, species_texts = reduce_block_by_primary_genome( block, primary_species, chrom, start )
+                for spec, text in species_texts.items():
+                    #we should trim gaps from both sides, since these are not positions in this species genome (sequence)
+                    text = text.rstrip( gap_chars_str )
+                    gap_offset = 0
+                    while text.startswith( gap_chars_tuple ):
+                        gap_offset += 1
+                        text = text[1:]
+                        if not text:
+                            break
+                    if text:
+                        if overwrite_with_gaps:
+                            alignment.set_range( start_offset + gap_offset, spec, text )
+                        else:
+                            for i, char in enumerate( text ):
+                                if char not in GAP_CHARS:
+                                    alignment.set_position( start_offset + gap_offset + i, spec, char )
     return alignment
 
 #returns a filled spliced region alignment for specified region with start and end lists
-def get_spliced_region_alignment( index, primary_species, chrom, starts, ends, strand = '+', species = None, mincols = 0 ):
+def get_spliced_region_alignment( index, primary_species, chrom, starts, ends, strand = '+', species = None, mincols = 0, overwrite_with_gaps = True ):
     #create spliced alignment object
     if species is not None: alignment = SplicedAlignment( starts, ends, species )
     else: alignment = SplicedAlignment( starts, ends, [primary_species] )
     for exon in alignment.exons:
-        fill_region_alignment( exon, index, primary_species, chrom, exon.start, exon.end, strand, species, mincols)
+        fill_region_alignment( exon, index, primary_species, chrom, exon.start, exon.end, strand, species, mincols, overwrite_with_gaps )
     return alignment
 
 #loop through string array, only return non-commented lines
@@ -319,29 +478,36 @@
             starts.append( start )
             ends.append( end )
     return ( starts, ends, fields )
-    
-def get_species_in_maf( maf_filename ):
-        try:
-            species={}
-            
-            file_in = open( maf_filename, 'r' )
-            maf_reader = maf.Reader( file_in )
-            
-            for i, m in enumerate( maf_reader ):
-                l = m.components
-                for c in l:
-                    spec, chrom = maf.src_split( c.src )
-                    if not spec or not chrom:
-                        spec = chrom = c.src
-                    species[spec] = spec
-            
-            file_in.close()
-            
-            species = species.keys()
-            species.sort()
-            return species
-        except:
-            return []
+
+def iter_components_by_src( block, src ):
+    for c in block.components:
+        if c.src == src:
+            yield c
+
+def get_components_by_src( block, src ):
+    return [ value for value in iter_components_by_src( block, src ) ]
+
+def iter_components_by_src_start( block, src ):
+    for c in block.components:
+        if c.src.startswith( src ):
+            yield c
+
+def get_components_by_src_start( block, src ):
+    return [ value for value in iter_components_by_src_start( block, src ) ]
+
+def sort_block_components_by_block( block1, block2 ):
+    #orders the components in block1 by the index of the component in block2
+    #block1 must be a subset of block2
+    #occurs in-place
+    return block1.components.sort( cmp = lambda x, y: block2.components.index( x ) - block2.components.index( y ) )
+
+def get_species_in_maf( maf_filename ):
+    species = []
+    for block in maf.Reader( open( maf_filename ) ):
+        for spec in get_species_in_block( block ):
+            if spec not in species:
+                species.append( spec )
+    return species
 
 def parse_species_option( species ):
     if species:
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/admin.py
--- a/lib/galaxy/web/controllers/admin.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/admin.py	Wed Sep 09 14:24:11 2009 -0400
@@ -2001,7 +2001,6 @@
                                         show_deleted=False,
                                         msg=msg,
                                         messagetype=messagetype )
-
     def _save_request_type(self, trans, **kwd):
         params = util.Params( kwd )
         num_states = int( util.restore_text( params.get( 'num_states', 0 ) ))
@@ -2031,7 +2030,6 @@
             ss.flush()
         msg = "The new request type named '%s' with %s state(s) has been created" % (rt.name, num_states)
         return rt, msg
-
     @web.expose
     @web.require_admin
     def delete_request_type( self, trans, **kwd ):
@@ -2045,7 +2043,6 @@
                                                           action='manage_request_types',
                                                           msg='Request type <b>%s</b> has been deleted' % rt.name,
                                                           messagetype='done') )
-        
     @web.expose
     @web.require_admin
     def undelete_request_type( self, trans, **kwd ):
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/dataset.py
--- a/lib/galaxy/web/controllers/dataset.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/dataset.py	Wed Sep 09 14:24:11 2009 -0400
@@ -109,10 +109,7 @@
         if not data:
             raise paste.httpexceptions.HTTPRequestRangeNotSatisfiable( "Invalid reference dataset id: %s." % str( dataset_id ) )
         user, roles = trans.get_user_and_roles()
-        if trans.app.security_agent.allow_action( user,
-                                                  roles,
-                                                  data.permitted_actions.DATASET_ACCESS,
-                                                  dataset=data.dataset ):
+        if trans.app.security_agent.can_access_dataset( roles, data.dataset ):
             if data.state == trans.model.Dataset.states.UPLOAD:
                 return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to view it." )
             if filename is None or filename.lower() == "index":
@@ -147,12 +144,9 @@
             return trans.show_error_message( 'Invalid parameters specified for "display at" link, please contact a Galaxy administrator' )
         redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] )
         user, roles = trans.get_user_and_roles()
-        if trans.app.security_agent.allow_action( None, None, data.permitted_actions.DATASET_ACCESS, dataset=data.dataset ):
+        if trans.app.security_agent.dataset_is_public( data.dataset ):
             return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac
-        if trans.app.security_agent.allow_action( user,
-                                                  roles,
-                                                  data.permitted_actions.DATASET_ACCESS,
-                                                  dataset=data.dataset ):
+        if trans.app.security_agent.can_access_dataset( roles, data.dataset ):
             trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site )
             return trans.response.send_redirect( redirect_url )
         else:
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/history.py
--- a/lib/galaxy/web/controllers/history.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/history.py	Wed Sep 09 14:24:11 2009 -0400
@@ -443,15 +443,9 @@
                     for hda in history.activatable_datasets:
                         # If the current dataset is not public, we may need to perform an action on it to
                         # make it accessible by the other user.
-                        if not trans.app.security_agent.allow_action( send_to_user,
-                                                                      send_to_user.all_roles(),
-                                                                      trans.app.security_agent.permitted_actions.DATASET_ACCESS, 
-                                                                      dataset=hda.dataset ):
+                        if not trans.app.security_agent.can_access_dataset( send_to_user.all_roles(), hda.dataset ):
                             # The user with which we are sharing the history does not have access permission on the current dataset
-                            if trans.app.security_agent.allow_action( user,
-                                                                      user_roles,
-                                                                      trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, 
-                                                                      dataset=hda.dataset ) and not hda.dataset.library_associations:
+                            if trans.app.security_agent.can_manage_dataset( user_roles, hda.dataset ) and not hda.dataset.library_associations:
                                 # The current user has authority to change permissions on the current dataset because
                                 # they have permission to manage permissions on the dataset and the dataset is not associated 
                                 # with a library.
@@ -556,15 +550,9 @@
                                 no_change_needed[ send_to_user ][ history ] = [ hda ]
                             else:
                                 no_change_needed[ send_to_user ][ history ].append( hda )
-                        elif not trans.app.security_agent.allow_action( send_to_user,
-                                                                        send_to_user.all_roles(),
-                                                                        trans.app.security_agent.permitted_actions.DATASET_ACCESS, 
-                                                                        dataset=hda.dataset ):
+                        elif not trans.app.security_agent.can_access_dataset( send_to_user.all_roles(), hda.dataset ):
                             # The user with which we are sharing the history does not have access permission on the current dataset
-                            if trans.app.security_agent.allow_action( user,
-                                                                      user_roles,
-                                                                      trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, 
-                                                                      dataset=hda.dataset ) and not hda.dataset.library_associations:
+                            if trans.app.security_agent.can_manage_dataset( user_roles, hda.dataset ) and not hda.dataset.library_associations:
                                 # The current user has authority to change permissions on the current dataset because
                                 # they have permission to manage permissions on the dataset and the dataset is not associated 
                                 # with a library.
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/library.py
--- a/lib/galaxy/web/controllers/library.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/library.py	Wed Sep 09 14:24:11 2009 -0400
@@ -2,6 +2,7 @@
 from galaxy.model.orm import *
 from galaxy.datatypes import sniff
 from galaxy import util
+from galaxy.util.odict import odict
 from galaxy.web.controllers.forms import get_all_forms, get_form_widgets
 from galaxy.util.streamball import StreamBall
 import logging, tempfile, zipfile, tarfile, os, sys
@@ -65,23 +66,24 @@
         user, roles = trans.get_user_and_roles()
         all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \
                                                .order_by( trans.app.model.Library.name ).all()
-        authorized_libraries = []
+        library_actions = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD,
+                            trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
+                            trans.app.security_agent.permitted_actions.LIBRARY_MANAGE ]
+        # The authorized_libraries dictionary looks like: { library : '1,2' }, library : '3' }
+        # Its keys are the libraries that should be displayed for the current user and whose values are a
+        # string of comma-separated folder ids, of the associated folders the should NOT be displayed.
+        # The folders that should not be displayed may not be a complete list, but it is ultimately passed
+        # to the browse_library() method and the browse_library.mako template to keep from re-checking the
+        # same folders when the library is rendered.
+        authorized_libraries = odict()
         for library in all_libraries:
-            if trans.app.security_agent.allow_action( user,
-                                                      roles,
-                                                      trans.app.security_agent.permitted_actions.LIBRARY_ADD,
-                                                      library_item=library ) or \
-               trans.app.security_agent.allow_action( user,
-                                                      roles,
-                                                      trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                      library_item=library ) or \
-               trans.app.security_agent.allow_action( user,
-                                                      roles,
-                                                      trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                      library_item=library ) or \
-               trans.app.security_agent.check_folder_contents( user, roles, library.root_folder ) or \
-               trans.app.security_agent.show_library_item( user, roles, library ):
-                authorized_libraries.append( library )
+            can_access, hidden_folder_ids = trans.app.security_agent.check_folder_contents( user, roles, library.root_folder )
+            if can_access:
+                authorized_libraries[ library ] = hidden_folder_ids
+            else:
+                can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, library_actions )
+                if can_show:
+                    authorized_libraries[ library ] = hidden_folder_ids
         return trans.fill_template( '/library/browse_libraries.mako', 
                                     libraries=authorized_libraries,
                                     default_action=params.get( 'default_action', None ),
@@ -94,6 +96,7 @@
         messagetype = params.get( 'messagetype', 'done' )
         id = params.get( 'id', None )
         if not id:
+            # To handle bots
             msg = "You must specify a library id."
             return trans.response.send_redirect( web.url_for( controller='library',
                                                               action='browse_libraries',
@@ -102,6 +105,7 @@
                                                               messagetype='error' ) )
         library = library=trans.app.model.Library.get( id )
         if not library:
+            # To handle bots
             msg = "Invalid library id ( %s )."
             return trans.response.send_redirect( web.url_for( controller='library',
                                                               action='browse_libraries',
@@ -109,9 +113,11 @@
                                                               msg=util.sanitize_text( msg ),
                                                               messagetype='error' ) )
         created_ldda_ids = params.get( 'created_ldda_ids', '' )
+        hidden_folder_ids = util.listify( util.restore_text( params.get( 'hidden_folder_ids', '' ) ) )
         return trans.fill_template( '/library/browse_library.mako', 
                                     library=trans.app.model.Library.get( id ),
                                     created_ldda_ids=created_ldda_ids,
+                                    hidden_folder_ids=hidden_folder_ids,
                                     default_action=params.get( 'default_action', None ),
                                     comptypes=comptypes,
                                     msg=msg,
@@ -278,10 +284,7 @@
             user, roles = trans.get_user_and_roles()
             for id in ldda_ids:
                 ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
-                if not ldda or not trans.app.security_agent.allow_action( user,
-                                                                          roles,
-                                                                          trans.app.security_agent.permitted_actions.DATASET_ACCESS,
-                                                                          dataset = ldda.dataset ):
+                if not ldda or not trans.app.security_agent.can_access_dataset( roles, ldda.dataset ):
                     continue
                 path = ""
                 parent_folder = ldda.library_dataset.folder
@@ -379,10 +382,7 @@
         user, roles = trans.get_user_and_roles()
         if action == 'information':
             if params.get( 'edit_attributes_button', False ):
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                          library_item=library_dataset ):
+                if trans.app.security_agent.can_modify_library_item( user, roles, library_dataset ):
                     if params.get( 'edit_attributes_button', False ):
                         old_name = library_dataset.name
                         new_name = util.restore_text( params.get( 'name', '' ) )
@@ -406,10 +406,7 @@
                                         messagetype=messagetype )
         elif action == 'permissions':
             if params.get( 'update_roles_button', False ):
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                          library_item=library_dataset ):
+                if trans.app.security_agent.can_manage_library_item( user, roles, library_dataset ):
                     # The user clicked the Save button on the 'Associate With Roles' form
                     permissions = {}
                     for k, v in trans.app.model.Library.permitted_actions.items():
@@ -496,14 +493,8 @@
             if action == 'permissions':
                 if params.get( 'update_roles_button', False ):
                     # The user clicked the Save button on the 'Associate With Roles' form
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                              library_item=ldda ) and \
-                        trans.app.security_agent.allow_action( user,
-                                                               roles,
-                                                               trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS,
-                                                               dataset=ldda.dataset ):
+                    if trans.app.security_agent.can_manage_library_item( user, roles, ldda ) and \
+                        trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ):
                         permissions = {}
                         for k, v in trans.app.model.Dataset.permitted_actions.items():
                             in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ]
@@ -542,10 +533,7 @@
             elif action == 'edit_info':
                 if params.get( 'change', False ):
                     # The user clicked the Save button on the 'Change data type' form
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                              library_item=ldda ):
+                    if trans.app.security_agent.can_modify_library_item( user, roles, ldda ):
                         if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
                             trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
                             trans.app.model.flush()
@@ -566,10 +554,7 @@
                                                 messagetype=messagetype )
                 elif params.get( 'save', False ):
                     # The user clicked the Save button on the 'Edit Attributes' form
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                              library_item=ldda ):
+                    if trans.app.security_agent.can_modify_library_item( user, roles, ldda ):
                         old_name = ldda.name
                         new_name = util.restore_text( params.get( 'name', '' ) )
                         new_info = util.restore_text( params.get( 'info', '' ) )
@@ -608,10 +593,7 @@
                                                 messagetype=messagetype )
                 elif params.get( 'detect', False ):
                     # The user clicked the Auto-detect button on the 'Edit Attributes' form
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                              library_item=ldda ):
+                    if trans.app.security_agent.can_modify_library_item( user, roles, ldda ):
                         for name, spec in ldda.datatype.metadata_spec.items():
                             # We need to be careful about the attributes we are resetting
                             if name not in [ 'name', 'info', 'dbkey' ]:
@@ -633,10 +615,7 @@
                                                 msg=msg,
                                                 messagetype=messagetype )
                 elif params.get( 'delete', False ):
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                              library_item=folder ):
+                    if trans.app.security_agent.can_modify_library_item( user, roles, folder ):
                         ldda.deleted = True
                         ldda.flush()
                         msg = 'Dataset %s has been removed from this library' % ldda.name
@@ -651,10 +630,7 @@
                                                 widgets=widgets,
                                                 msg=msg,
                                                 messagetype=messagetype )
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                          library_item=ldda ):
+                if trans.app.security_agent.can_modify_library_item( user, roles, ldda ):
                     ldda.datatype.before_edit( ldda )
                     if "dbkey" in ldda.datatype.metadata_spec and not ldda.metadata.dbkey:
                         # Copy dbkey into metadata, for backwards compatability
@@ -692,14 +668,8 @@
                                                            messagetype='error' ) )
             if action == 'permissions':
                 if params.get( 'update_roles_button', False ):
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                              library_item=ldda ) and \
-                        trans.app.security_agent.allow_action( user,
-                                                               roles,
-                                                               trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS,
-                                                               dataset=ldda.dataset ):
+                    if trans.app.security_agent.can_manage_library_item( user, roles, ldda ) and \
+                        trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ):
                         permissions = {}
                         for k, v in trans.app.model.Dataset.permitted_actions.items():
                             in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ]
@@ -730,14 +700,8 @@
                                                 library_id=library_id,
                                                 msg=msg,
                                                 messagetype=messagetype )
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                          library_item=ldda ) and \
-                    trans.app.security_agent.allow_action( user,
-                                                           roles,
-                                                           trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS,
-                                                           dataset=ldda.dataset ):
+                if trans.app.security_agent.can_manage_library_item( user, roles, ldda ) and \
+                    trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ):
                     # Ensure that the permissions across all library items are identical, otherwise we can't update them together.
                     check_list = []
                     for ldda in lddas:
@@ -769,14 +733,8 @@
                                             library_id=library_id,
                                             msg=msg,
                                             messagetype=messagetype )
-        if trans.app.security_agent.allow_action( user,
-                                                  roles,
-                                                  trans.app.security_agent.permitted_actions.LIBRARY_ADD,
-                                                  library_item=folder ) or \
-             ( replace_dataset and trans.app.security_agent.allow_action( user,
-                                                                          roles,
-                                                                          trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                                          library_item=replace_dataset ) ):
+        if trans.app.security_agent.can_add_library_item( user, roles, folder ) or \
+             ( replace_dataset and trans.app.security_agent.can_modify_library_item( user, roles, replace_dataset ) ):
             if params.get( 'new_dataset_button', False ):
                 upload_option = params.get( 'upload_option', 'upload_file' )
                 created_ldda_ids = trans.webapp.controllers[ 'library_dataset' ].upload_dataset( trans,
@@ -799,10 +757,7 @@
                     # Since permissions on all LibraryDatasetDatasetAssociations must be the same at this point, we only need
                     # to check one of them to see if the current user can manage permissions on them.
                     check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] )
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                              library_item=check_ldda ):
+                    if trans.app.security_agent.can_manage_library_item( user, roles, check_ldda ):
                         if replace_dataset:
                             default_action = ''
                         else:
@@ -924,10 +879,7 @@
                     # to check one of them to see if the current user can manage permissions on them.
                     check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] )
                     user, roles = trans.get_user_and_roles()
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              trans.app.security_agent.permitted_actions.LIBRARY_MANAGE,
-                                                              library_item=check_ldda ):
+                    if trans.app.security_agent.can_manage_library_item( user, roles, check_ldda ):
                         if replace_dataset:
                             default_action = ''
                         else:
@@ -1028,10 +980,7 @@
             else:
                 widgets = []
             if params.get( 'rename_folder_button', False ):
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, 
-                                                          library_item=folder ):
+                if trans.app.security_agent.can_modify_library_item( user, roles, folder ):
                     old_name = folder.name
                     new_name = util.restore_text( params.name )
                     new_description = util.restore_text( params.description )
@@ -1072,10 +1021,7 @@
         elif action == 'permissions':
             if params.get( 'update_roles_button', False ):
                 # The user clicked the Save button on the 'Associate With Roles' form
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, 
-                                                          library_item=folder ):
+                if trans.app.security_agent.can_manage_library_item( user, roles, folder ):
                     permissions = {}
                     for k, v in trans.app.model.Library.permitted_actions.items():
                         in_roles = [ trans.app.model.Role.get( int( x ) ) for x in util.listify( params.get( k + '_in', [] ) ) ]
@@ -1198,24 +1144,40 @@
                                                           msg=util.sanitize_text( msg ),
                                                           messagetype='done' ) )
 
-def get_authorized_libs( trans, user ):
-    # TODO: this is a mis-named function - the name should reflect the authorization policy
-    # If user is not authenticated, this method should not even be called.  Also, it looks
-    # like all that is using this is the new request stuff, so it should be placed there.
-    if not user:
-        return []
-    roles = user.all_roles()
-    all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \
-                                           .order_by( trans.app.model.Library.name ).all()
-    authorized_libraries = []
-    for library in all_libraries:
-        if trans.app.security_agent.allow_action( user,
-                                                  roles,
-                                                  trans.app.security_agent.permitted_actions.LIBRARY_ADD,
-                                                  library_item=library ) \
-            or trans.app.security_agent.allow_action( user,
-                                                      roles,
-                                                      trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
-                                                      library_item=library ):
-            authorized_libraries.append( library )
-    return authorized_libraries
+# ---- Utility methods -------------------------------------------------------
+
+def active_folders( trans, folder ):
+    # Much faster way of retrieving all active sub-folders within a given folder than the
+    # performance of the mapper.  This query also eagerloads the permissions on each folder.
+    return trans.sa_session.query( trans.app.model.LibraryFolder ) \
+                           .filter_by( parent=folder, deleted=False ) \
+                           .options( eagerload_all( "actions" ) ) \
+                           .order_by( trans.app.model.LibraryFolder.table.c.name ) \
+                           .all()
+def activatable_folders( trans, folder ):
+    return trans.sa_session.query( trans.app.model.LibraryFolder ) \
+                           .filter_by( parent=folder, purged=False ) \
+                           .options( eagerload_all( "actions" ) ) \
+                           .order_by( trans.app.model.LibraryFolder.table.c.name ) \
+                           .all()
+def active_folders_and_lddas( trans, folder ):
+    folders = active_folders( trans, folder )
+    # This query is much faster than the folder.active_library_datasets property
+    lddas = trans.sa_session.query( trans.app.model.LibraryDatasetDatasetAssociation ) \
+                            .filter_by( deleted=False ) \
+                            .join( "library_dataset" ) \
+                            .filter( trans.app.model.LibraryDataset.table.c.folder_id==folder.id ) \
+                            .order_by( trans.app.model.LibraryDatasetDatasetAssociation.table.c.name ) \
+                            .all()
+    return folders, lddas
+def activatable_folders_and_lddas( trans, folder ):
+    folders = activatable_folders( trans, folder )
+    # This query is much faster than the folder.activatable_library_datasets property
+    lddas = trans.sa_session.query( trans.app.model.LibraryDatasetDatasetAssociation ) \
+                            .join( "library_dataset" ) \
+                            .filter( trans.app.model.LibraryDataset.table.c.folder_id==folder.id ) \
+                            .join( "dataset" ) \
+                            .filter( trans.app.model.Dataset.table.c.deleted==False ) \
+                            .order_by( trans.app.model.LibraryDatasetDatasetAssociation.table.c.name ) \
+                            .all()
+    return folders, lddas
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/requests.py
--- a/lib/galaxy/web/controllers/requests.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/requests.py	Wed Sep 09 14:24:11 2009 -0400
@@ -4,13 +4,12 @@
 from galaxy.datatypes import sniff
 from galaxy import util
 from galaxy.util.streamball import StreamBall
+from galaxy.util.odict import odict
 import logging, tempfile, zipfile, tarfile, os, sys
 from galaxy.web.form_builder import * 
 from datetime import datetime, timedelta
 from cgi import escape, FieldStorage
 from galaxy.web.controllers.forms import get_form_widgets
-from galaxy.web.controllers.library import get_authorized_libs 
-
 
 log = logging.getLogger( __name__ )
 
@@ -432,8 +431,6 @@
                 return self.__show_request_form(trans, **kwd)
         elif params.get('refresh', False) == 'true':
             return self.__show_request_form(trans, **kwd)
-                
-
     def __show_request_form(self, trans, **kwd):
         params = util.Params( kwd )
         msg = util.restore_text( params.get( 'msg', ''  ) )
@@ -460,7 +457,25 @@
                             helptext='(Optional)'))
        
         # libraries selectbox
-        libraries = get_authorized_libs(trans, trans.user)
+        all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \
+                                               .order_by( trans.app.model.Library.name ).all()
+        user, roles = trans.get_user_and_roles()
+        actions_to_check = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD ]
+        # The libraries dictionary looks like: { library : '1,2' }, library : '3' }
+        # Its keys are the libraries that should be displayed for the current user and whose values are a
+        # string of comma-separated folder ids, of the associated folders the should NOT be displayed.
+        # The folders that should not be displayed may not be a complete list, but it is ultimately passed
+        # to the calling method to keep from re-checking the same folders when the library / folder
+        # select lists are rendered.
+        #
+        # TODO: RC, when you add the folders select list to your request form, take advantage of the hidden_folder_ids
+        # so that you do not need to check those same folders yet again when populating the select list.
+        #
+        libraries = odict()
+        for library in all_libraries:
+            can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, actions_to_check )
+            if can_show:
+                libraries[ library ] = hidden_folder_ids
         libui = self.__library_ui(libraries, **kwd)
         widgets = widgets + libui
         widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd)
@@ -470,12 +485,10 @@
                                     widgets=widgets,
                                     msg=msg,
                                     messagetype=messagetype)
-        
     def __library_ui(self, libraries, request=None, **kwd):
         params = util.Params( kwd )
         lib_id = params.get( 'library_id', 'none'  )
-        lib_list = SelectField('library_id', refresh_on_change=True, 
-                               refresh_on_change_values=['new'])
+        lib_list = SelectField( 'library_id', refresh_on_change=True, refresh_on_change_values=['new'] )
         if request and lib_id == 'none':
             if request.library:
                 lib_id = str(request.library.id)
@@ -483,7 +496,7 @@
             lib_list.add_option('Select one', 'none', selected=True)
         else:
             lib_list.add_option('Select one', 'none')
-        for lib in libraries:
+        for lib, hidden_folder_ids in libraries.items():
             if str(lib.id) == lib_id:
                 lib_list.add_option(lib.name, lib.id, selected=True)
             else:
@@ -653,9 +666,27 @@
         widgets.append(dict(label='Description', 
                             widget=TextField('desc', 40, desc), 
                             helptext='(Optional)'))
-       
         # libraries selectbox
-        libraries = get_authorized_libs(trans, trans.user)
+        all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \
+                                               .order_by( trans.app.model.Library.name ).all()
+        user, roles = trans.get_user_and_roles()
+        actions_to_check = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD ]
+        # The libraries dictionary looks like:
+        # { library : '1,2' }, library : '3' }
+        # Its keys are the libraries that should be displayed for the current user and whose values are a
+        # string of comma-separated folder ids, of the associated folders the should NOT be displayed.
+        # The folders that should not be displayed may not be a complete list, but it is ultimately passed
+        # to the calling method to keep from re-checking the same folders when the library / folder
+        # select lists are rendered.
+        #
+        # TODO: RC, when you add the folders select list to your request form, take advantage of the hidden_folder_ids
+        # so that you do not need to check those same folders yet again when populating the select list.
+        #
+        libraries = {}
+        for library in all_libraries:
+            can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, actions_to_check )
+            if can_show:
+                libraries[ library ] = hidden_folder_ids
         libui = self.__library_ui(libraries, request, **kwd)
         widgets = widgets + libui
         widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd)
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/requests_admin.py
--- a/lib/galaxy/web/controllers/requests_admin.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/requests_admin.py	Wed Sep 09 14:24:11 2009 -0400
@@ -8,7 +8,6 @@
 from galaxy.web.form_builder import * 
 from datetime import datetime, timedelta
 from galaxy.web.controllers.forms import get_form_widgets
-from galaxy.web.controllers.library import get_authorized_libs 
 
 log = logging.getLogger( __name__ )
 
@@ -709,14 +708,32 @@
         return select_user
         
     def __library_ui(self, trans, user, request=None, **kwd):
+        """
+        Return a list of libraries for which user has the permission
+        to perform the LIBRARY_ADD action on any of it's folders
+        """
         params = util.Params( kwd )
         lib_id = params.get( 'library_id', 'none'  )
-        if not user:
-            libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all()
-        else:
-            libraries = get_authorized_libs(trans, user)
-        lib_list = SelectField('library_id', refresh_on_change=True, 
-                               refresh_on_change_values=['new'])
+        all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \
+                                               .order_by( trans.app.model.Library.name ).all()
+        roles = user.all_roles()
+        actions_to_check = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD ]
+        # The libraries dictionary looks like: { library : '1,2' }, library : '3' }
+        # Its keys are the libraries that should be displayed for the current user and whose values are a
+        # string of comma-separated folder ids, of the associated folders the should NOT be displayed.
+        # The folders that should not be displayed may not be a complete list, but it is ultimately passed
+        # to the calling method to keep from re-checking the same folders when the library / folder
+        # select lists are rendered.
+        #
+        # TODO: RC, when you add the folders select list to your request form, take advantage of the hidden_folder_ids
+        # so that you do not need to check those same folders yet again when populating the select list.
+        #
+        libraries = {}
+        for library in all_libraries:
+            can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, actions_to_check )
+            if can_show:
+                libraries[ library ] = hidden_folder_ids
+        lib_list = SelectField( 'library_id', refresh_on_change=True, refresh_on_change_values=['new'] )
         if request and lib_id == 'none':
             if request.library:
                 lib_id = str(request.library.id)
@@ -724,7 +741,7 @@
             lib_list.add_option('Select one', 'none', selected=True)
         else:
             lib_list.add_option('Select one', 'none')
-        for lib in libraries:
+        for lib, hidden_folder_ids in libraries.items():
             if str(lib.id) == lib_id:
                 lib_list.add_option(lib.name, lib.id, selected=True)
             else:
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/root.py
--- a/lib/galaxy/web/controllers/root.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/controllers/root.py	Wed Sep 09 14:24:11 2009 -0400
@@ -153,10 +153,7 @@
                 return "Dataset id '%s' is invalid" %str( id )
         if data:
             user, roles = trans.get_user_and_roles()
-            if trans.app.security_agent.allow_action( user,
-                                                      roles,
-                                                      data.permitted_actions.DATASET_ACCESS,
-                                                      dataset = data.dataset ):
+            if trans.app.security_agent.can_access_dataset( roles, data.dataset ):
                 mime = trans.app.datatypes_registry.get_mimetype_by_extension( data.extension.lower() )
                 trans.response.set_content_type(mime)
                 if tofile:
@@ -189,10 +186,7 @@
                 child = data.get_child_by_designation( designation )
                 if child:
                     user, roles = trans.get_user_and_roles()
-                    if trans.app.security_agent.allow_action( user,
-                                                              roles,
-                                                              child.permitted_actions.DATASET_ACCESS,
-                                                              dataset = child ):
+                    if trans.app.security_agent.can_access_dataset( roles, child ):
                         return self.display( trans, id=child.id, tofile=tofile, toext=toext )
                     else:
                         return "You are not privileged to access this dataset."
@@ -209,10 +203,7 @@
             authz_method = kwd['authz_method']
         if data:
             user, roles = trans.get_user_and_roles()
-            if authz_method == 'rbac' and trans.app.security_agent.allow_action( user,
-                                                                                 roles,
-                                                                                 data.permitted_actions.DATASET_ACCESS,
-                                                                                 dataset = data ):
+            if authz_method == 'rbac' and trans.app.security_agent.can_access_dataset( roles, data ):
                 trans.response.set_content_type( data.get_mime() )
                 trans.log_event( "Formatted dataset id %s for display at %s" % ( str( id ), display_app ) )
                 return data.as_display_type( display_app, **kwd )
@@ -262,10 +253,7 @@
         if id is not None and data.history.user is not None and data.history.user != trans.user:
             return trans.show_error_message( "This instance of a dataset (%s) in a history does not belong to you." % ( data.id ) )
         user, roles = trans.get_user_and_roles()
-        if trans.app.security_agent.allow_action( user,
-                                                  roles,
-                                                  data.permitted_actions.DATASET_ACCESS,
-                                                  dataset=data.dataset ):
+        if trans.app.security_agent.can_access_dataset( roles, data.dataset ):
             if data.state == trans.model.Dataset.states.UPLOAD:
                 return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to edit its metadata." )
             params = util.Params( kwd, safe=False )
@@ -331,10 +319,7 @@
             elif params.update_roles_button:
                 if not trans.user:
                     return trans.show_error_message( "You must be logged in if you want to change permissions." )
-                if trans.app.security_agent.allow_action( user,
-                                                          roles,
-                                                          data.dataset.permitted_actions.DATASET_MANAGE_PERMISSIONS,
-                                                          dataset = data.dataset ):
+                if trans.app.security_agent.can_manage_dataset( roles, data.dataset ):
                     permissions = {}
                     for k, v in trans.app.model.Dataset.permitted_actions.items():
                         in_roles = params.get( k + '_in', [] )
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/framework/__init__.py
--- a/lib/galaxy/web/framework/__init__.py	Tue Sep 08 17:33:38 2009 -0400
+++ b/lib/galaxy/web/framework/__init__.py	Wed Sep 09 14:24:11 2009 -0400
@@ -503,7 +503,7 @@
         if user:
             roles = user.all_roles()
         else:
-            roles = None
+            roles = []
         return user, roles
 
     def user_is_admin( self ):
diff -r eba44fc830bf -r c3b40f23a0e0 static/images/pileup_parser_help1.png
Binary file static/images/pileup_parser_help1.png has changed
diff -r eba44fc830bf -r c3b40f23a0e0 static/images/pileup_parser_help2.png
Binary file static/images/pileup_parser_help2.png has changed
diff -r eba44fc830bf -r c3b40f23a0e0 templates/admin/library/browse_library.mako
--- a/templates/admin/library/browse_library.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/admin/library/browse_library.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -1,17 +1,15 @@
 <%inherit file="/base.mako"/>
-<%namespace file="common.mako" import="render_dataset" />
 <%namespace file="/message.mako" import="render_msg" />
-<% from galaxy import util %>
+<%
+    from time import strftime
+    from galaxy import util
+    from galaxy.web.controllers.library import active_folders_and_lddas, activatable_folders_and_lddas
+%>
 
 <%def name="stylesheets()">
     <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" />
     <link href="${h.url_for('/static/style/library.css')}" rel="stylesheet" type="text/css" />
 </%def>
-
-<%
-def name_sorted( l ):
-    return sorted( l, lambda a, b: cmp( a.name.lower(), b.name.lower() ) )
-%>
 
 <script type="text/javascript">
     $( document ).ready( function () {
@@ -72,24 +70,77 @@
     }
 </script>
 
-<%def name="render_folder( folder, folder_pad, deleted, show_deleted, created_ldda_ids, library_id )">
+<%def name="render_dataset( ldda, library_dataset, selected, library, folder, deleted, show_deleted )">
     <%
-        root_folder = not folder.parent
+        ## The received data must always be a LibraryDatasetDatasetAssociation object.  The object id passed to methods
+        ## from the drop down menu should be the ldda id to prevent id collision ( which could happen when displaying
+        ## children, which are always lddas ).  We also need to make sure we're displaying the latest version of this
+        ## library_dataset, so we display the attributes from the ldda.
+        if ldda.user:
+            uploaded_by = ldda.user.email
+        else:
+            uploaded_by = 'anonymous'
+        if ldda == library_dataset.library_dataset_dataset_association:
+            current_version = True
+        else:
+            current_version = False
+    %>
+    <div class="historyItemWrapper historyItem historyItem-${ldda.state}" id="libraryItem-${ldda.id}">
+        ## Header row for library items (name, state, action buttons)
+        <div class="historyItemTitleBar">     
+            <table cellspacing="0" cellpadding="0" border="0" width="100%">
+                <tr>
+                    <td width="*">
+                        %if selected:
+                            <input type="checkbox" name="ldda_ids" value="${ldda.id}" checked/>
+                        %else:
+                            <input type="checkbox" name="ldda_ids" value="${ldda.id}"/>
+                        %endif
+                        <span class="libraryItemDeleted-${ldda.deleted}">
+                            <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a>
+                        </span>
+                        <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a>
+                        %if not library.deleted and not folder.deleted and not library_dataset.deleted:
+                            <div popupmenu="dataset-${ldda.id}-popup">
+                                <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
+                                ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use
+                                ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a>
+                                <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
+                                %if current_version:
+                                    <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a>
+                                %endif
+                                %if ldda.has_data:
+                                    <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a>
+                                %endif
+                                <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a>
+                            </div>
+                        %elif not library.deleted and not folder.deleted and library_dataset.deleted:
+                            <div popupmenu="dataset-${ldda.id}-popup">
+                                <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a>
+                            </div>
+                        %endif
+                    </td>
+                    <td width="300">${ldda.message}</td>
+                    <td width="150">${uploaded_by}</td>
+                    <td width="60">${ldda.create_time.strftime( "%Y-%m-%d" )}</td>
+                </tr>
+            </table>
+        </div>
+    </div>
+</%def>
+
+<%def name="render_folder( folder, folder_pad, deleted, show_deleted, created_ldda_ids, library_id, root_folder=False )">
+    <%
         if root_folder:
             pad = folder_pad
+            expander = "/static/images/silk/resultset_bottom.png"
+            folder_img = "/static/images/silk/folder_page.png"
         else:
             pad = folder_pad + 20
-        if folder_pad == 0:
-            expander = "/static/images/silk/resultset_bottom.png"
-            folder_img = "/static/images/silk/folder_page.png"
-            subfolder = False
-        else:
             expander = "/static/images/silk/resultset_next.png"
             folder_img = "/static/images/silk/folder.png"
-            subfolder = True
-        created_ldda_id_list = util.listify( created_ldda_ids )
-        if created_ldda_id_list:
-           created_ldda_ids = [ int( ldda_id ) for ldda_id in created_ldda_id_list ]
+        if created_ldda_ids:
+            created_ldda_ids = [ int( ldda_id ) for ldda_id in util.listify( created_ldda_ids ) ]
     %>
     %if not root_folder:
         <li class="folderRow libraryOrFolderRow" style="padding-left: ${pad}px;">
@@ -104,10 +155,6 @@
                 </div>
             %endif
             %if not folder.deleted:
-                <%
-                    library_item_ids = {}
-                    library_item_ids[ 'folder' ] = folder.id
-                %>
                 <div popupmenu="folder-${folder.id}-popup">
                     <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a>
                     <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a>
@@ -130,30 +177,31 @@
             %endif
         </li>
     %endif
-    %if subfolder:
+    %if pad > 0:
         <ul id="subFolder">
     %else:
         <ul>
     %endif
         %if show_deleted:
             <%
-                parent_folders = folder.activatable_folders
-                parent_datasets = folder.activatable_library_datasets
+                sub_folders, lddas = activatable_folders_and_lddas( trans, folder )
             %>
         %else:
             <%
-                parent_folders = folder.active_folders
-                parent_datasets = folder.active_library_datasets
+                sub_folders, lddas = active_folders_and_lddas( trans, folder )
             %>
         %endif
-        %for folder in name_sorted( parent_folders ):
-            ${render_folder( folder, pad, deleted, show_deleted, created_ldda_ids, library_id )}
-        %endfor    
-        %for library_dataset in name_sorted( parent_datasets ):
+        %for sub_folder in sub_folders:
+            ${render_folder( sub_folder, pad, deleted, show_deleted, created_ldda_ids, library_id )}
+        %endfor 
+        %for ldda in lddas:
             <%
-                selected = created_ldda_ids and library_dataset.library_dataset_dataset_association.id in created_ldda_ids
+                library_dataset = ldda.library_dataset
+                selected = created_ldda_ids and ldda.id in created_ldda_ids
             %>
-            <li class="datasetRow" style="padding-left: ${pad + 18}px;">${render_dataset( library_dataset, selected, library, deleted, show_deleted )}</li>
+            <li class="datasetRow" style="padding-left: ${pad + 18}px;">
+                ${render_dataset( ldda, library_dataset, selected, library, folder, deleted, show_deleted )}
+            </li>
         %endfor
     </ul>
 </%def>
@@ -196,10 +244,6 @@
                         <a id="library-${library.id}-popup" class="popup-arrow" style="display: none;">▼</a>
                         <div popupmenu="library-${library.id}-popup">
                         %if not deleted:
-                            <%
-                                library_item_ids = {}
-                                library_item_ids[ 'library' ] = library.id
-                            %>
                             <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this data library's information</a>
                             ## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition
                             ##%if library.info_association:
@@ -228,7 +272,7 @@
             </div>
         </li>
         <ul>
-            ${render_folder( library.root_folder, 0, deleted, show_deleted, created_ldda_ids, library.id )}
+            ${render_folder( library.root_folder, 0, deleted, show_deleted, created_ldda_ids, library.id, root_folder=True )}
         </ul>
         <br/>
     </ul>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/admin/library/common.mako
--- a/templates/admin/library/common.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/admin/library/common.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -1,68 +1,3 @@
-<% from time import strftime %>
-
-<%def name="render_dataset( library_dataset, selected, library, deleted, show_deleted )">
-    <%
-        ## The received data must always be a LibraryDataset object, but the object id passed to methods from the drop down menu
-        ## should be the underlying ldda id to prevent id collision ( which could happen when displaying children, which are always
-        ## lddas ).  We also need to make sure we're displaying the latest version of this library_dataset, so we display the attributes
-        ## from the ldda.
-        ldda = library_dataset.library_dataset_dataset_association
-        if ldda.user:
-            uploaded_by = ldda.user.email
-        else:
-            uploaded_by = 'anonymous'
-        if ldda == ldda.library_dataset.library_dataset_dataset_association:
-            current_version = True
-        else:
-            current_version = False
-    %>
-    <div class="historyItemWrapper historyItem historyItem-${ldda.state}" id="libraryItem-${ldda.id}">
-        ## Header row for library items (name, state, action buttons)
-        <div class="historyItemTitleBar">     
-            <table cellspacing="0" cellpadding="0" border="0" width="100%">
-                <tr>
-                    <td width="*">
-                        %if selected:
-                            <input type="checkbox" name="ldda_ids" value="${ldda.id}" checked/>
-                        %else:
-                            <input type="checkbox" name="ldda_ids" value="${ldda.id}"/>
-                        %endif
-                        <span class="libraryItemDeleted-${library_dataset.deleted}">
-                            <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a>
-                        </span>
-                        <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a>
-                        %if not library.deleted and not library_dataset.folder.deleted and not library_dataset.deleted:
-                            <%
-                                library_item_ids = {}
-                                library_item_ids[ 'ldda' ] = ldda.id
-                            %>
-                            <div popupmenu="dataset-${ldda.id}-popup">
-                                <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
-                                ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use
-                                ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a>
-                                <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
-                                %if current_version:
-                                    <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a>
-                                %endif
-                                %if ldda.has_data:
-                                    <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a>
-                                %endif
-                                <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a>
-                            </div>
-                        %elif not library.deleted and not library_dataset.folder.deleted and library_dataset.deleted:
-                            <div popupmenu="dataset-${ldda.id}-popup">
-                                <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a>
-                            </div>
-                        %endif
-                    </td>
-                    <td width="300">${ldda.message}</td>
-                    <td width="150">${uploaded_by}</td>
-                    <td width="60">${ldda.create_time.strftime( "%Y-%m-%d" )}</td>
-                </tr>
-            </table>
-        </div>
-    </div>
-</%def>
 
 <%def name="render_template_info( library_item, library_id, widgets, editable=True )">
     <%
diff -r eba44fc830bf -r c3b40f23a0e0 templates/admin/library/ldda_info.mako
--- a/templates/admin/library/ldda_info.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/admin/library/ldda_info.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -86,26 +86,14 @@
         <div class="form-row">
             <div>${ldda.blurb}</div>
         </div>
-        <div class="form-row">
-           <div id="info${ldda.id}" class="historyItemBody">
-                %if ldda.peek != "no peek":
+        %if ldda.peek != "no peek":
+            <div class="form-row">
+               <div id="info${ldda.id}" class="historyItemBody">
                     <label>Peek:</label>
                     <div><pre id="peek${ldda.id}" class="peek">${ldda.display_peek()}</pre></div>
-                %endif
-                ## Recurse for child datasets
-                %if len( ldda.visible_children ) > 0:
-                    <div>
-                        There are ${len( ldda.visible_children )} secondary datasets.
-                        %for idx, child in enumerate( ldda.visible_children ):
-                            ## TODO: do we need to clarify if the child is deleted?
-                            %if not child.purged:
-                                ${ render_dataset( child, selected, library, False, False ) }
-                            %endif
-                        %endfor
-                    </div>
-                %endif
+                </div>
             </div>
-        </div>
+        %endif
     </div>
     %if widgets:
         ${render_template_info( ldda, library.id, widgets, editable=False )}
diff -r eba44fc830bf -r c3b40f23a0e0 templates/dataset/edit_attributes.mako
--- a/templates/dataset/edit_attributes.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/dataset/edit_attributes.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -189,7 +189,7 @@
 </div>
 <p />
 
-%if trans.app.security_agent.allow_action( user, user_roles, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=data.dataset ):
+%if trans.app.security_agent.can_manage_dataset( user_roles, data.dataset ):
     <%namespace file="/dataset/security_common.mako" import="render_permission_form" />
     ${render_permission_form( data.dataset, data.name, h.url_for( controller='root', action='edit', id=data.id ), user_roles )}
 %elif trans.user:
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/browse_libraries.mako
--- a/templates/library/browse_libraries.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/browse_libraries.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -20,9 +20,9 @@
             </tr>
         </thead>
         <tbody>
-            %for library in libraries:    
+            %for library, hidden_folder_ids in libraries.items():    
                 <tr class="libraryRow libraryOrFolderRow" id="libraryRow">
-                    <td><a href="${h.url_for( controller='library', action='browse_library', id=library.id )}">${library.name}</a></td>
+                    <td><a href="${h.url_for( controller='library', action='browse_library', id=library.id, hidden_folder_ids=hidden_folder_ids )}">${library.name}</a></td>
                     <td><i>${library.description}</i></td>
                 </tr>             
             %endfor
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/browse_library.mako
--- a/templates/library/browse_library.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/browse_library.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -2,8 +2,8 @@
 <%namespace file="/message.mako" import="render_msg" />
 <% 
     from galaxy import util
+    from galaxy.web.controllers.library import active_folders
     from time import strftime
-    
     user, roles = trans.get_user_and_roles()
 %>
 
@@ -14,10 +14,6 @@
 </%def>
 
 <%
-
-def name_sorted( l ):
-    return sorted( l, lambda a, b: cmp( a.name.lower(), b.name.lower() ) )
-
 class RowCounter( object ):
     def __init__( self ):
         self.count = 0
@@ -83,21 +79,22 @@
     });
 </script>
 
-<%def name="render_dataset( library_dataset, selected, library, pad, parent, row_conter )">
+<%def name="render_dataset( ldda, library_dataset, selected, library, folder, pad, parent, row_conter )">
     <%
-        ## The received data must always be a LibraryDataset object, but the object id passed to methods from the drop down menu
-        ## should be the underlying ldda id to prevent id collision ( which could happen when displaying children, which are always
-        ## lddas ).  We also need to make sure we're displaying the latest version of this library_dataset, so we display the attributes
+        ## The id passed to methods from the drop down menu should be the ldda id to prevent id collision
+        ## ( which could happen when displaying children, which are always lddas ).  We also need to make
+        ## sure we're displaying the latest version of this library_dataset, so we display the attributes
         ## from the ldda.
-        ldda = library_dataset.library_dataset_dataset_association
         if ldda.user:
             uploaded_by = ldda.user.email
         else:
             uploaded_by = 'anonymous'
-        if ldda == ldda.library_dataset.library_dataset_dataset_association:
+        if ldda == library_dataset.library_dataset_dataset_association:
             current_version = True
         else:
             current_version = False
+        can_modify_library_dataset = trans.app.security_agent.can_modify_library_item( user, roles, library_dataset )
+        can_manage_library_dataset = trans.app.security_agent.can_manage_library_item( user, roles, library_dataset )
     %>
 
     <tr class="datasetRow"
@@ -112,19 +109,19 @@
             %else:
                 <input type="checkbox" name="ldda_ids" value="${ldda.id}"/>
             %endif
-            <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a>
+            <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a>
             <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a>
             <div popupmenu="dataset-${ldda.id}-popup">
-                %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ):
-                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
+                %if can_modify_library_dataset:
+                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
                 %else:
-                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a>
+                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, information=True )}">View this dataset's information</a>
                 %endif
-                %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ):
-                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
-                %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ):
-                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a>
+                %if can_manage_library_dataset:
+                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
                 %endif
+                %if current_version and can_modify_library_dataset:
+                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a>
                 %endif
                 %if ldda.has_data:
                     <a class="action-button" href="${h.url_for( controller='library', action='datasets', library_id=library.id, ldda_ids=str( ldda.id ), do_action='add' )}">Import this dataset into your current history</a>
@@ -142,31 +139,30 @@
     %>
 </%def>
 
-<%def name="render_folder( folder, folder_pad, created_ldda_ids, library_id, parent=None, row_counter=None )">
+<%def name="render_folder( folder, folder_pad, created_ldda_ids, library_id, hidden_folder_ids, parent=None, row_counter=None, root_folder=False )">
     <%
-        def show_folder():
-            ## TODO: instead of calling check_folder_contents(), which we've already done prior to getting here,
-            ## add a new method that will itself call check_folder_contents() and build a list of accessible folders
-            ## for each library - this should improve performance dor large libraries where the current user can only
-            ## access a small number of folders.
-            if trans.app.security_agent.check_folder_contents( user, roles, folder ) or \
-                trans.app.security_agent.show_library_item( user, roles, folder ):
-                return True
-            return False
-        if not show_folder:
+        if str( folder.id ) in hidden_folder_ids:
             return ""
-        root_folder = not folder.parent
+        can_access, folder_ids = trans.app.security_agent.check_folder_contents( user, roles, folder )
+        if not can_access:
+            can_show, folder_ids = \
+                trans.app.security_agent.show_library_item( user,
+                                                            roles,
+                                                            folder,
+                                                            [ trans.app.security_agent.permitted_actions.LIBRARY_ADD,
+                                                              trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
+                                                              trans.app.security_agent.permitted_actions.LIBRARY_MANAGE ] )
+            if not can_show:
+                return ""
         if root_folder:
             pad = folder_pad
         else:
             pad = folder_pad + 20
-        if folder_pad == 0:
-            subfolder = False
-        else:
-            subfolder = True
-        created_ldda_id_list = util.listify( created_ldda_ids )
-        if created_ldda_id_list:
-           created_ldda_ids = [ int( ldda_id ) for ldda_id in created_ldda_id_list ]
+        if created_ldda_ids:
+            created_ldda_ids = [ int( ldda_id ) for ldda_id in util.listify( created_ldda_ids ) ]
+        can_add = trans.app.security_agent.can_add_library_item( user, roles, folder )
+        can_modify = trans.app.security_agent.can_modify_library_item( user, roles, folder )
+        can_manage = trans.app.security_agent.can_manage_library_item( user, roles, folder )
         my_row = None
     %>
     %if not root_folder:
@@ -186,21 +182,19 @@
                 %endif
                 <a id="folder_img-${folder.id}-popup" class="popup-arrow" style="display: none;">▼</a>
                 <div popupmenu="folder_img-${folder.id}-popup">
-                    %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ):
+                    %if can_add:
                         <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a>
                         <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a>
                     %endif
-                    %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ):
+                    %if can_modify:
                         <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a>
                     %else:
                         <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">View this folder's information</a>
                     %endif
-                    %if forms and not folder.info_association:
-                        %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ):
-                            <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this folder</a>
-                        %endif
+                    %if can_add and forms and not folder.info_association:
+                        <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this folder</a>
                     %endif
-                    %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ):
+                    %if can_manage:
                         <a class="action-button" href="${h.url_for( controller='library', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a>
                     %endif
                 </div>
@@ -212,43 +206,48 @@
             row_counter.increment()
         %>
     %endif
-    %for child_folder in name_sorted( folder.active_folders ):
-        ${render_folder( child_folder, pad, created_ldda_ids, library_id, my_row, row_counter )}
+    <% sub_folders = active_folders( trans, folder ) %>
+    %for sub_folder in sub_folders:
+        ${render_folder( sub_folder, pad, created_ldda_ids, library_id, hidden_folder_ids, parent=my_row, row_counter=row_counter )}
     %endfor
-    %for library_dataset in name_sorted( folder.active_library_datasets ):
+    %for library_dataset in folder.active_library_datasets:
         <%
-            selected = created_ldda_ids and library_dataset.library_dataset_dataset_association.id in created_ldda_ids
+            ldda = library_dataset.library_dataset_dataset_association
+            can_access = trans.app.security_agent.can_access_dataset( roles, ldda.dataset )
+            selected = created_ldda_ids and ldda.id in created_ldda_ids
         %>
-        %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ):
-            ${render_dataset( library_dataset, selected, library, pad, my_row, row_counter )}
+        %if can_access:
+            ${render_dataset( ldda, library_dataset, selected, library, folder, pad, my_row, row_counter )}
         %endif
     %endfor
 </%def>
 
 <h2>Data Library “${library.name}”</h2>
 
+<%
+can_add = trans.app.security_agent.can_add_library_item( user, roles, library )
+can_modify = trans.app.security_agent.can_modify_library_item( user, roles, library )
+can_manage = trans.app.security_agent.can_manage_library_item( user, roles, library )
+%>
+
 <ul class="manage-table-actions">
-    %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ):
-            %if not deleted:
-                <li>
-                    <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a>
-                </li>
-                <li>
-                    <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this library</a>
-                </li>
-            %endif
+    %if can_add and not_deleted:
+        <li>
+            <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a>
+        </li>
+        <li>
+            <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this library</a>
+        </li>
     %endif
-    %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ):
+    %if can_modify:
         <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">Edit this library's information</a></li>
     %else:
         <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">View this library's information</a></li>
     %endif
-    %if forms and not library.info_association:
-        %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ):
-            <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a>
-        %endif
+    %if can_add and forms and not library.info_association:
+        <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a>
     %endif
-    %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ):
+    %if can_manage:
         <li><a class="action-button" href="${h.url_for( controller='library', action='library', permissions=True, id=library.id )}">Edit this library's permissions</a></li>
     %endif 
 </ul>
@@ -258,10 +257,6 @@
 %endif
 
 <form name="import_from_library" action="${h.url_for( controller='library', action='datasets', library_id=library.id )}" method="post">
-    <%
-        library_item_ids = {}
-        library_item_ids[ 'library' ] = library.id
-    %>
     <table cellspacing="0" cellpadding="0" border="0" width="100%" class="grid" id="library-grid">
         <thead>
             <tr class="libraryTitle">
@@ -272,7 +267,7 @@
             </thead>
         </tr>
         <% row_counter = RowCounter() %>
-        ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, None, row_counter )}
+        ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, hidden_folder_ids, parent=None, row_counter=row_counter, root_folder=True )}
         <tfoot>
             <tr>
                 <td colspan="4" style="padding-left: 42px;">
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/common.mako
--- a/templates/library/common.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/common.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -21,7 +21,7 @@
         <div class="toolForm">
             <div class="toolFormTitle">Other information about ${library_item_desc} ${library_item.name}</div>
             <div class="toolFormBody">
-                %if editable and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_item ):
+                %if editable and trans.app.security_agent.can_modify_library_item( user, roles, library_item ):
                     <form name="edit_info" action="${h.url_for( controller='library', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post">
                         <input type="hidden" name="library_item_id" value="${library_item.id}"/>
                         <input type="hidden" name="library_item_type" value="${library_item_type}"/>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/folder_info.mako
--- a/templates/library/folder_info.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/folder_info.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -18,7 +18,7 @@
 <div class="toolForm">
     <div class="toolFormTitle">Edit folder name and description</div>
     <div class="toolFormBody">
-        %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ):
+        %if trans.app.security_agent.can_modify_library_item( user, roles, folder ):
             <form name="folder" action="${h.url_for( controller='library', action='folder', rename=True, id=folder.id, library_id=library_id )}" method="post" >
                 <div class="form-row">
                     <label>Name:</label>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/folder_permissions.mako
--- a/templates/library/folder_permissions.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/folder_permissions.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -15,6 +15,6 @@
     ${render_msg( msg, messagetype )}
 %endif
 
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ):
+%if trans.app.security_agent.can_manage_library_item( user, roles, folder ):
     ${render_permission_form( folder, folder.name, h.url_for( controller='library', action='folder', id=folder.id, library_id=library_id, permissions=True ), trans.user.all_roles() )}
 %endif
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/ldda_edit_info.mako
--- a/templates/library/ldda_edit_info.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/ldda_edit_info.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -34,7 +34,7 @@
     </select>
 </%def>
 
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ):
+%if trans.app.security_agent.can_modify_library_item( user, roles, ldda.library_dataset ):
     <div class="toolForm">
         <div class="toolFormTitle">Edit attributes of ${ldda.name}</div>
         <div class="toolFormBody">
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/ldda_info.mako
--- a/templates/library/ldda_info.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/ldda_info.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -40,15 +40,15 @@
         Information about ${ldda.name}
         <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a>
         <div popupmenu="dataset-${ldda.id}-popup">
-            %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ):
+            %if trans.app.security_agent.can_modify_library_item( user, roles, ldda.library_dataset ):
                 <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
             %else:
                 <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a>
             %endif
-            %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ):
+            %if trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ) and trans.app.security_agent.can_manage_library_item( user, roles, ldda.library_dataset ):
                 <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
             %endif
-            %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ):
+            %if current_version and trans.app.security_agent.can_modify_library_item( user, roles, ldda.library_dataset ):
                 <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a>
             %endif
             %if ldda.has_data:
@@ -86,28 +86,14 @@
         <div class="form-row">
             <div>${ldda.blurb}</div>
         </div>
-        <div class="form-row">
-           <div id="info${ldda.id}" class="historyItemBody">
-                %if ldda.peek != "no peek":
+        %if ldda.peek != "no peek":
+            <div class="form-row">
+               <div id="info${ldda.id}" class="historyItemBody">
                     <label>Peek:</label>
                     <div><pre id="peek${ldda.id}" class="peek">${ldda.display_peek()}</pre></div>
-                %endif
-                ## Recurse for child datasets
-                ## TODO: eliminate this - child datasets are deprecated, and where does
-                ## render_dataset() come from anyway - it's not imported!
-                %if len( ldda.visible_children ) > 0:
-                    <div>
-                        There are ${len( ldda.visible_children )} secondary datasets.
-                        %for idx, child in enumerate( ldda.visible_children ):
-                            ## TODO: do we need to clarify if the child is deleted?
-                            %if not child.purged:
-                                ${ render_dataset( child, selected, library ) }
-                            %endif
-                        %endfor
-                    </div>
-                %endif
+                </div>
             </div>
-        </div>
+        %endif
     </div>
     %if widgets:
         ${render_template_info( ldda, library_id, widgets, editable=False )}
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_dataset_info.mako
--- a/templates/library/library_dataset_info.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/library_dataset_info.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -21,7 +21,7 @@
     ${render_msg( msg, messagetype )}
 %endif
 
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ):
+%if trans.app.security_agent.can_modify_library_item( user, roles, library_dataset ):
     <div class="toolForm">
         <div class="toolFormTitle">Edit attributes of ${library_dataset.name}</div>
         <div class="toolFormBody">
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_dataset_permissions.mako
--- a/templates/library/library_dataset_permissions.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/library_dataset_permissions.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -21,7 +21,7 @@
     ${render_msg( msg, messagetype )}
 %endif
 
-%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_manage, library_item=library_dataset ):
+%if trans.app.security_agent.can_manage_library_item( user, user_roles, library_dataset ):
     <%
         roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all()
     %>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_info.mako
--- a/templates/library/library_info.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/library_info.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -15,7 +15,7 @@
     ${render_msg( msg, messagetype )}
 %endif
 
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ):
+%if trans.app.security_agent.can_modify_library_item( user, roles, library ):
     <div class="toolForm">
         <div class="toolFormTitle">Change library name and description</div>
         <div class="toolFormBody">
diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_permissions.mako
--- a/templates/library/library_permissions.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/library/library_permissions.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -15,7 +15,7 @@
     ${render_msg( msg, messagetype )}
 %endif
 
-%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ):
+%if trans.app.security_agent.can_manage_library_item( user, user_roles, library ):
     <%
         roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all()
     %>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/mobile/history/detail.mako
--- a/templates/mobile/history/detail.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/mobile/history/detail.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -37,7 +37,7 @@
         <div class="secondary">
         ## Body for history items, extra info and actions, data "peek"
         	<% user, roles = trans.get_user_and_roles() %>
-            %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ):
+            %if not trans.app.security_agent.can_access_dataset( roles, data.dataset ):
                 <div>You do not have permission to view this dataset.</div>
             %elif data_state == "queued":
                 <div>Job is waiting to run</div>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/mobile/manage_library.mako
--- a/templates/mobile/manage_library.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/mobile/manage_library.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -9,7 +9,7 @@
     ${render_msg( msg, messagetype )}
 %endif
 
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ):
+%if trans.app.security_agent.can_modify_library_item( user, roles, library ):
     <div class="toolForm">
         <div class="toolFormTitle">Change library name and description</div>
         <div class="toolFormBody">
@@ -55,7 +55,7 @@
         </div>
     </div>
 %endif
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ):
+%if trans.app.security_agent.can_manage_library_item( user, roles, library ):
     <%
         roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all()
     %>
diff -r eba44fc830bf -r c3b40f23a0e0 templates/root/history_common.mako
--- a/templates/root/history_common.mako	Tue Sep 08 17:33:38 2009 -0400
+++ b/templates/root/history_common.mako	Wed Sep 09 14:24:11 2009 -0400
@@ -8,7 +8,7 @@
     	    data_state = data.state
     	user, roles = trans.get_user_and_roles()
     %>
-    %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ):
+    %if not trans.app.security_agent.can_access_dataset( roles, data.dataset ):
         <div class="historyItemWrapper historyItem historyItem-${data_state} historyItem-noPermission" id="historyItem-${data.id}">
     %else:
         <div class="historyItemWrapper historyItem historyItem-${data_state}" id="historyItem-${data.id}">
@@ -42,7 +42,7 @@
         ## Body for history items, extra info and actions, data "peek"
         
         <div id="info${data.id}" class="historyItemBody">
-            %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ):
+            %if not trans.app.security_agent.can_access_dataset( roles, data.dataset ):
                 <div>You do not have permission to view this dataset.</div>
             %elif data_state == "upload":
                 <div>Dataset is uploading</div>
diff -r eba44fc830bf -r c3b40f23a0e0 test-data/cf_maf2fasta_new.dat
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cf_maf2fasta_new.dat	Wed Sep 09 14:24:11 2009 -0400
@@ -0,0 +1,134 @@
+>hg17.chr7(+):127471195-127471526|sequence_index=0|block_index=0|species=hg17|hg17_0_0
+gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATC---ATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGG-------------------------------------------------------TATGAA---------AACATCCACTAA
+>panTro1.chr6(+):129885076-129885407|sequence_index=0|block_index=0|species=panTro1|panTro1_0_0
+gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATC---ATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGG-------------------------------------------------------TATGAA---------AACATCCACTAA
+>rheMac2.chr3(+):165787989-165788319|sequence_index=0|block_index=0|species=rheMac2|rheMac2_0_0
+gcttgccatcttttgatgctcttgggaatccagcagctgtcaccat-taaacaagcccaggctagaccaGTTACCCTCATC---ATCTTAGCTGATAGCCAGCCAGCCACCATAGGCAtgagtcaggccatagtgctggacccacagaattatgagctaaataagtagtgttgggttaagtcactaagttttaggcatagtgtgttatgtagcTCACAAACATATAAGACTGTGTGTTTTTTGACTGGAGGAAGAGATGCCATAAAGACCACCTTTTGAAACTTCTCAAATACTGCCATTGATGTGCTGATGGAGG-------------------------------------------------------TATGAA---------AACATCCACTAA
+>rn3.chr4(+):56178191-56178473|sequence_index=0|block_index=0|species=rn3|rn3_0_0
+CTTCACTCTCATTTGCTGTT----------------CTGTCACTATGGAGACAAACACAGGCTAGCCCAGTTACTATCTTGATCACAGCAGCTGT----CAGCTAGCTGCCACTCACAGGAATAAGGCCATACCATT-GATCCACTGAACCTTGATCTAGGAATTTGGC----------------------TGGGGCCAGTTTGCGGTGTCACTCATGA--CTCTAAGATTGTGTGTTTG----CTCCAGGAAGAGACGGCAAGAGGATTACCTTTAAAAGGTTCGG-AGTCTAGCTGTAGACAGCCCAATGGG---------------------------------------------------------TATAAC---------AATACTCACTAA
+>mm7.chr6(+):28984529-28984886|sequence_index=0|block_index=0|species=mm7|mm7_0_0
+CTCCACTCTCGTTTGCTGTT----------------CTGTCACCATGGAAACAAACG-AGGGTGGTCCAGTTACTATCTTG---ACTGCAGCTGG----CAGTCAGTTGCCACT--CAGGAATAAGGCTATGCCATT-GATCCACTGAACCGTGATCTGGAAACCTGGCTGTTGTTT-------CAAGCCTTGGGGCCAGTTTGCGGTGTTACTCATGA--CTCTAAGATCGTGTGCTTG----CTGCAGGAAGAGACAGCAAGGGGGTTACATTTAAAAAGCCCCC-AGTTTAGCTATAGGCAGGCCAACAGGTGTAAAAATACTCACTAGTAATGGGCTGAACTCATGGAGGTAGCATTAGTGAGACACTGTAACTGTTTTTTTAAAAATCACTAA
+
+>hg17.chr7(+):127471526-127471584|sequence_index=0|block_index=1|species=hg17|hg17_1_0
+AATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
+>mm7.chr6(+):28984886-28984940|sequence_index=0|block_index=1|species=mm7|mm7_1_0
+----AACGTTTCATTGATTGCTCATCATTTAAAAAAAGAAATTCCTCAGTGGAAGAGG
+>rheMac2.chr3(+):165788319-165788377|sequence_index=0|block_index=1|species=rheMac2|rheMac2_1_0
+AATTTGTGGTTTATTTATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
+>panTro1.chr6(+):129885407-129885465|sequence_index=0|block_index=1|species=panTro1|panTro1_1_0
+AATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
+
+>hg17.chr7(+):127471584-127471688|sequence_index=0|block_index=2|species=hg17|hg17_2_0
+GAGATATTT-GGggaaatttt-gtatagactagctt--tcacgatgttagggaattattattgtgtgataatggtcttgcagttac-acagaaattcttcctta-ttttt
+>panTro1.chr6(+):129885465-129885569|sequence_index=0|block_index=2|species=panTro1|panTro1_2_0
+GAGACATTT-GGggaaatttt-gtatagactagctt--tcacgatgttagggagttattattgtgtgataatggtcttgcagttac-acagaaattcttcctta-ttttt
+>rheMac2.chr3(+):165788377-165788482|sequence_index=0|block_index=2|species=rheMac2|rheMac2_2_0
+GAGATATTT-GGggaaatttg-gtatagactagctt--tcatgatgtaagggagttatttttgtgtgataatggccctacagttac-acagaaattcttccttatttttt
+>canFam2.chr14(-):11090703-11090811|sequence_index=0|block_index=2|species=canFam2|canFam2_2_0
+gagatattt-gggggaatttgaatgtagtgttgctcttttgtgatgctaagaaattataattgtctgatgatagtctcgtggttatgggggaaatgcttcctta-ttttt
+>bosTau2.chr4(-):50243931-50244034|sequence_index=0|block_index=2|species=bosTau2|bosTau2_2_0
+-agacattg-ggtaaaattcaaatgcagactagctc----atgatgttaaagaattactcttgtgtggtaatggtcttgtgatagagatagaaatgcttcctta-ttttt
+>rn3.chr4(+):56182200-56182295|sequence_index=0|block_index=2|species=rn3|rn3_2_0
+----TATTTGGGGGAAATATG-ATGTGCA----CTT--CCATGATCTTAAAGAATTGCTACTGTTTGATAGTGATCTTATGGTTAA-ATAAAAAAAAT--CTTA-GTTGT
+>dasNov1.scaffold_256527(+):298-392|sequence_index=0|block_index=2|species=dasNov1|dasNov1_2_0
+GAGACATTT-GGAGAAATTTG-----------Aatt--tcatgatgttaaggaattacttttgtatgatgatggtcttgtggctat-gtagaatttcttccgtg-tttta
+
+>hg17.chr7(+):127471688-127471871|sequence_index=0|block_index=3|species=hg17|hg17_3_0
+tgggaagcaccaaagta-------gggataaaatgtcatgatgtgtgcaatacactttaaaatgtttttgccaaaa----------taattaa-------------------------tgaagc--aaatatg---gaaaataataattattaaatctaggt-----gatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaatttttcattta--------------------------aaaa-
+>panTro1.chr6(+):129885569-129885752|sequence_index=0|block_index=3|species=panTro1|panTro1_3_0
+tgggaaacaccaaagta-------gggataaaatgtcatgatgtgtgcaatacgctttaaaatatttttgccaaaa----------taattaa-------------------------tgaagc--aaatatg---gaaaataataattattaaatctaggt-----gatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaaattttcattta--------------------------aaaa-
+>rheMac2.chr3(+):165788482-165788684|sequence_index=0|block_index=3|species=rheMac2|rheMac2_3_0
+tgggaagcacaaaagta-------gggataaaatgtcatgatgtgtacaatatgctttaaaatatttttgccaaaa----------taattaa-------------------------tgaagc--aaatatg---gaaaataataactgttaaatctaggt-----gttgggtatattgcagttcattatgttattgcacacttttctgtgtgtttaaaattttcatttaaaaatatgttttaaaaatg-------aaaa-
+>rn3.chr4(+):56182295-56182489|sequence_index=0|block_index=3|species=rn3|rn3_3_0
+TAGAAAATACTCAAATATTTAGGGGCGTGACAATGTCACAGTGTCTGCAATTTGCTTTAAAGATTTTT-----AAA----------TATTTAAAAAAGTTTTAATAATTTTGAAAAACTGAAGCTACACTATG---GGAAGTGGTAATTGTTACATATGGGT-----AATAAGTAT-----AATTCGTTATATTAT-------TTTTC------TTAGAATTTTTCATTTG--------------------------AAAA-
+>bosTau2.chr4(-):50243792-50243930|sequence_index=0|block_index=3|species=bosTau2|bosTau2_3_0
+agataaacacttaagtattta---aggatgaaacgccctgatgtttgtaatttgctttagaatattttagccaaaa----------gaattaa-------------------------tgatgc--aaatatg--caaaaagagta--cgttaaacctaa-----------------------------------------------------atttgCGATTttcattta--------------------------aaaa-
+>canFam2.chr14(-):11090345-11090505|sequence_index=0|block_index=3|species=canFam2|canFam2_3_0
+agacacaaactgaagtattta---aggatgaaatgtcatgatgtttgcaattggctttaaaatattttagccaaaa-----------agtaaa-------------------------tgaagc--AAATATG--GGAAGACAATAATCATTAAATCTAGGT-----GATGCATAC---------------------------TTTTCCATATGTTTGAAATTTTCATTTA--------------------------AAAA-
+>dasNov1.scaffold_256527(+):393-625|sequence_index=0|block_index=3|species=dasNov1|dasNov1_3_0
+agacgcatgctgaagcatgta---aggataaaatgtcgtggtgtttgtaatttattctaaaacattttagccaaaaacaaataaataaataaa-------------------------tgaagc--aaatatgggggaaatgtttaattgttaaatctagatttaacacggtatataccgtgcttcattatactagtctctacttttccatgtgtttgaaattttCATTAAAATGTTTGTTTGTTGTCTGTTTTAATGAAAT
+
+>hg17.chr7(+):127471871-127471910|sequence_index=0|block_index=4|species=hg17|hg17_4_0
+actttgagctagacaccaggctatgagcta-ggagcatag
+>rheMac2.chr3(+):165788684-165788723|sequence_index=0|block_index=4|species=rheMac2|rheMac2_4_0
+actttgagctagataccaggttatgagcta-ggagcatag
+>panTro1.chr6(+):129885752-129885791|sequence_index=0|block_index=4|species=panTro1|panTro1_4_0
+actttgagctagacaccaggctatgagcta-ggagcatag
+>bosTau2.chr4(-):50243734-50243773|sequence_index=0|block_index=4|species=bosTau2|bosTau2_4_0
+tcttcgtgcaacgcacggggctatcaatgt-gggatacag
+>canFam2.chr14(-):11090081-11090120|sequence_index=0|block_index=4|species=canFam2|canFam2_4_0
+ACATCAtgctagatcctggactatgagctg-ggtatatag
+>dasNov1.scaffold_256527(+):625-665|sequence_index=0|block_index=4|species=dasNov1|dasNov1_4_0
+CCTTTGTGCTAGCCACTGGGATGAAAGCTAGGGAACACAG
+
+>hg17.chr7(+):127471910-127472074|sequence_index=0|block_index=5|species=hg17|hg17_5_0
+caatgaccaa----------------------------------------------------------------------------------------------atagactcctaccaa-ctc-aaagaatgcacattctCTG-GGAAACATGTTTCCATTAGGAAGCCTCGAATGCAATGTGACTGTGGTCTCCAGGACCTG-TGTGATCCTGGCTTTTCCTGTTCCCTCCG---CATCATCACTGCAGGTGTGTTTTCCCAAG
+>panTro1.chr6(+):129885791-129885955|sequence_index=0|block_index=5|species=panTro1|panTro1_5_0
+caatgaccaa----------------------------------------------------------------------------------------------atagactcctaccaa-ctc-aaagaatgcacattctCTG-GGAAACATGTTTCCATTAGGAAGCCTCGAATGCAATGTGACTGTGGTCTCCAGGACATG-TGTGATCCTGGCTTTTCCTGTTCCCTCTG---CATCATCACTGCAGGTGTATTTTCCCAAG
+>rheMac2.chr3(+):165788723-165788885|sequence_index=0|block_index=5|species=rheMac2|rheMac2_5_0
+caatgaccaa----------------------------------------------------------------------------------------------atagacccctaccga-ctc-aaagaatgtacattctTTG-GGAAACATGTTTCCATCAGAAAATCTCAAATGCAATGTGACTGGGGTCTCCAGGACCTG-TGTGAGCCTGGCTTTTCCTGTTCCCTCCA---CATCATCACTGCAGGTGTATTTTCCC--G
+>mm7.chr6(+):28990714-28990875|sequence_index=0|block_index=5|species=mm7|mm7_5_0
+caaaaaccaa------------------------------------------------------------------------------------------------aaaaACCTATAGC-CTC-ACAGGGTGGGTTGTCTTTG-AGGAACATGCATCCGCTAGAAAGTCCCAAGTACACTATGACAGTTG--CCCAGGCCCCGCCTTAAACCTGGTTTTCCTGGTTTCTTTCA---CATCATTACCACGAATATATTTCCTCAAG
+>rn3.chr4(+):56183448-56183705|sequence_index=0|block_index=5|species=rn3|rn3_5_0
+--ATGACCAATATACACTGTTTACATGTATAGCATTGTGAATGGAGACATAAAAAGATAATCTAGCTTTGTGCTAGGTAGGTGCTGAGCTCTTAACAGTGCTGGGCAGAAACCTATAAC-CTC-ACAGGGTGGGTTGTCTTTG-AGGAGCGTGCTAACCCTAGGAAGTCTCAAATACAATGTGATGGTTGCCCCCAGGCACCACCTTGAACCTGGTCTTCCTGGTTTCTTTCA---CACCATTACCACAAATACATTTTCTCAGG
+>bosTau2.chr4(-):50243566-50243734|sequence_index=0|block_index=5|species=bosTau2|bosTau2_5_0
+atgtgaacaa---------------------------------------------------------------------------------------------aacggacccgtgtgggactcggcggagcacacagattttgcgggagCACGTTCCCGTTAGGAAGTCTCTGATGCAATACGACCGGTGCCTTCAGGACCTG-TG--AGGCTGACTTTCCTTA-CCCCTCCACACCATCATCAAGGCAGGTGTGATTTTCCAGG
+>canFam2.chr14(-):11089913-11090081|sequence_index=0|block_index=5|species=canFam2|canFam2_5_0
+cagtgaacaa---------------------------------------------------------------------------------------------aacagagccctgcagt-cttgatggagcacacaacctttg-gggaaCATGTTTCCATAAGAAAGTCTCCAATGTGATCTGA-TGGTGCCGCCAGGACCTA-TGTCAGCCTACCGTTCCATGTCCCCTCCACACCATCATCACTGCAGGTGTGTTTTCCCACA
+>dasNov1.scaffold_256527(+):665-786|sequence_index=0|block_index=5|species=dasNov1|dasNov1_5_0
+CAGTGAGCAA-----------------------------------------------------------------------------------------------CAGCCTGGCTCCGT-CC--GGGGGCCGCTCAGCAGCTC-GGGAGCGTGGAGACG---GGAAGTCTGTCACGCGATGCG-----------CTGGGCCCG------------CTGTTCCCGCCCCCCTCC---CCCC----------------TTTCCCAAG
+
+>hg17.chr7(+):127472074-127472258|sequence_index=0|block_index=6|species=hg17|hg17_6_0
+TTTTAAA------CATTTACCTTCCCAGTGGCCTTGCGTCTAGAGGAATCCCTGTATAGTGGT-ACATGAATATAACACATAACAAA-AATCATCTCTATGGTGTGTGTTGTTCCTGGGGTTCAattcagcaaatttt-ccc-tgggcacccatgtgttcttggcactggaaaagtaccgggactgaaacagtt
+>panTro1.chr6(+):129885955-129886139|sequence_index=0|block_index=6|species=panTro1|panTro1_6_0
+TTTTAAA------CATTTACCTTCCCAGTGGCCTTGCGTCTAGAGGAATCCCTGTATAGTGGT-ACATGAATATAACACATAACAAA-AATCATCTCTATGGTGTGTGTTGTTCCTGGGGTTCAattcagcaaatttt-tcc-tgggcacccatgtgttcttggcactggaaaagtaccgggactgaaacagtt
+>rheMac2.chr3(+):165788885-165789069|sequence_index=0|block_index=6|species=rheMac2|rheMac2_6_0
+TTTTAAA------CATTTACTCTCCCAGTAGCCTTGCATCTCGAGGAATCCCTGTATAGTGGT-ACATGAATATAACACATAACAAA-AATCATCTGTACGGTGTGTGTTGTTCCTGGGGTTCAattcagcaaatttt-tcc-tgggcacccctgtgttcttggcactggaaaagtaccaggacttaaatagta
+>mm7.chr6(+):28990875-28991025|sequence_index=0|block_index=6|species=mm7|mm7_6_0
+TTTAAAGAAAGTACCCCCTCCTTTCCAGT-GCCTCAAATCTAGAAGAATATTCATAGTGAAGT-GC------------------------ACAGCCGGGTGGTGCATGGTA-ATCTGGAAGTCACCTCTGCAAATCTT-TCC----------------TGTTGGTGCTGTGAAGGCACCAGGACTTCAAGAGTA
+>rn3.chr4(+):56183705-56183879|sequence_index=0|block_index=6|species=rn3|rn3_6_0
+TTTAAAAGAAGT-CCCACTCCTTTCCAGT-GCCCTAGATCTAGAAGCACATTCATAATGATGT-ACAC-----TAACCC----------GACAGCTGTGTGGTATATGGTA-TCCCGGAAGTCACCTCAGCAAACCTT-TCCCGGGGAACCTACATGGTGTTGGTGCTGTGAAGGTACCAGGTTGTCAAGGGTA
+>canFam2.chr14(-):11089743-11089913|sequence_index=0|block_index=6|species=canFam2|canFam2_6_0
+TTTTAAA------TATCTGC-TTCCCGGTGGCCTTGAGTCTAGAGGAGTCCCCCCACTATGGTGGCACTAATACTGAAGGTCAGAAATAATCAGTTCTGTGGTGCATGTTGCCCCTGAGGTTCTGTTCGGGAAACTTC-TTC-TGAGCAC----ATGCACCTGGCACTGCAAACGTACCAGGA-----------
+>dasNov1.scaffold_256527(+):786-964|sequence_index=0|block_index=6|species=dasNov1|dasNov1_6_0
+TTTTAAA------AATTTACCTTCCCAGTGGCGGTGAATCCGGAGGAATACGGAAACTGGGGC-GCACTACCATGACACGTGTCAAA-AATCAGTTCCGTGGTCCGTGGAGGGCCTGGGGTTC------GAAAATCTTGTCC-CGAGCACCCCCGTGCGCCTGGCACCGCGACAGTGACAGGACTGAAGCGTG-
+
+>hg17.chr7(+):127472258-127472280|sequence_index=0|block_index=7|species=hg17|hg17_7_0
+gatggccca-atccctgtcctct-
+>panTro1.chr6(+):129886139-129886161|sequence_index=0|block_index=7|species=panTro1|panTro1_7_0
+gatggccca-atccctgtcctct-
+>rheMac2.chr3(+):165789069-165789091|sequence_index=0|block_index=7|species=rheMac2|rheMac2_7_0
+gatggccca-atccctgtcctct-
+>mm7.chr6(+):28991025-28991048|sequence_index=0|block_index=7|species=mm7|mm7_7_0
+AATGGCAGAGGGCTCTGTTCTCT-
+>rn3.chr4(+):56183879-56183902|sequence_index=0|block_index=7|species=rn3|rn3_7_0
+AATGGCAGAGGCCCCTGTTCTCT-
+>canFam2.chr14(-):11089526-11089548|sequence_index=0|block_index=7|species=canFam2|canFam2_7_0
+GGAGACTTG-ATGCCTGCCTTCC-
+>dasNov1.scaffold_256527(+):964-987|sequence_index=0|block_index=7|species=dasNov1|dasNov1_7_0
+GACGGCCAG-ACCTCTGCCCTCGG
+
+>hg17.chr7(+):127472280-127472681|sequence_index=0|block_index=8|species=hg17|hg17_8_0
+taaaacctaagggaggagaTGGAAAG-GGGCACCCAACCCAGACTGAGAGACAGGAATTAGCTGCAAGGGGAACTAGGAAAAGCTTCTTTA---AGGATG--GAGAGGCCCTA-GTGGAATGGGGAGATTCTTCCGGGAGAAGCGATGGATGCACAGTTGGGCATCCCCACAGACGGACTGGAAAGAAAAAAGGCCTGGAGGAATCA------ATGTGC-AATGTATGTGTGTTCCCTGGTTcaagggctgg-gaactttctcta--aagggccaggtagaaaacattttaggctttctaagccaagg---caaaattgaggat-attacatgggtacttatacaacaagaataaacaatt---tacacaa-ttttttgttgacagaattcaaaa---ctttat----agacac---agaaatgcaaatttcctgt
+>panTro1.chr6(+):129886161-129886562|sequence_index=0|block_index=8|species=panTro1|panTro1_8_0
+taaaacctaagggaggagaTGGAAAG-GGGCACCCAACCCAGACTGAGAGACAGGAATTAGCTGCAAGGGGAACTAGGAAAAGCTTCTTTA---AGGATG--GAGAGACCCTA-GTGGAATGGGGAGATTCTTCCGGGAGAAGCGATGGATGCGCAGTTGGGCATCCCCACAGACGGACTGGAAAGAAAAAAGGCCTGGAGGAATCA------ATGTGC-AATGTATGTGTGTTCCCTGGTTcaagggctgg-gaactttctcta--aagggccaggtagaaaacattttaggctttctaagccaagg---caaaattgaggat-attacatgggtacttatacaacaagaataaacaatt---tacacaa-ttttttgttgacagaattcaaaa---ctttat----agacac---agaaatgtaaatttcctgt
+>rheMac2.chr3(+):165789091-165789492|sequence_index=0|block_index=8|species=rheMac2|rheMac2_8_0
+taaaacctaatggaggagatggaATG-GGTCACCCAACCCGGACTGAGAGACAGGAATTAGCTGCAAGGGTAACCAGGACAAGCTTCTCTA---ATGATG--GAGAGACCCTA-GTGGAATGGGGAGATTCTTCTGGGAGAAGCGATGGATTCGTAGTTGGGCATCCCCACAGAGGGACTGGAAAGAAAAAAGACCTGGAGGAACCA------ATGTGC-AATGTATGTGTGTTTCCTGGTTcaagggctggcaaactttctcta--aagggccagatagaaaacattttaggctttgtaagccaagg---caaaatcgaggag-attacatgggtacttatacaacaagaataaacaatt---tccacaa--tttttattcacagaattcaaaa---ctttat----agacac---agaaatgtaaatttcctgt
+>rn3.chr4(+):56183902-56184219|sequence_index=0|block_index=8|species=rn3|rn3_8_0
+------------------------------------GTCCATAGTCAAAG------------------------------AAGCCTCTCAG---ATGGAG--AGCAGGGCCTATGCAAAAGAGGGGGCTTCTGTAGGCAGAAGGGATGGACTAGCCTCCGGACATAGCCATAGAGAGGCTGGCAGGACTGAGACCCAGGAGAAGCCAGCGCAGGTGTGCGGGCGTGTGTATATTTCATAGTTTGCAGGTTGG----------------------------CAAACAATTCCTGCTTTGCAGGCCAAGA---GGAAACTGAAGGTGACCCCGTGAGTGCTTAC---ACAAGAGAAAACAAG-------ACAA-TTTTTGGTTGACCAAATTCAGAA---CTTTATTTGAGGATGC---TAAAGTTTAAATTTCTTTT
+>canFam2.chr14(-):11089143-11089523|sequence_index=0|block_index=8|species=canFam2|canFam2_8_0
+TACAGCCTGTGGGCAGAGGTGGGAAGAGGTCACGCAAGCCAGTTGGAATGAGGGGAGTTGGCTGGAAAGGTGACCAGGACAAGCTACTTCAACCAGGAAG--AAGAGACCCCG-GTG----------------CTTGGAGAAGGCCTGATTGAGCAGTCCTGCATGCCCGCCCAC-GACTGGCAGGAATAAAGACCCAGAAGAGCTA------ACGTGC-AATGTA------TTTTCTAGTTCCAgggttggcaaactttctctct-aagggtgggatgataaacattttaggcttttcagaccaaga---ggcgacatcagag-ggtatgtaggt---------acaagagggaaaagttgcccccggaa-ttttttg--gataaaattcaaaa---ctttacttagggatgc---caaaatgtaaacttcatat
+>dasNov1.scaffold_256527(+):987-1401|sequence_index=0|block_index=8|species=dasNov1|dasNov1_8_0
+CTAAATCTCGCGGAGAAGGTGGAACA-GGTTACCCAAACCCGACCGAG-GAGGCGAGTTG---GAAACGGCGACTGGGACAAGCTCCCTCA---GAGACGGAGAGAGACCCCA-GTGGAAGGGGGGAGAGGCTCTTAGGGAAACGATGGGGGGACCCGCCCGCACCCGCACAGAGGCGCTGGCAGGCACAGCGGCCCCGAGGAGCCC------AGGAGC-AGGGC-TGTGT-TCCCCTGCATcaggggttggcaaactttttctgcaaagggccagatagtaaatattttaggctttgcaaaccaagaagtagaaagggaggcc-attatgtacgtatttatatagcaagagagaacattt---cccacaatttttttattgacagaatttaaaacttctttattgatgaacaccaaagaaacttgaatttcatat
+
+>hg17.chr7(+):127472681-127472715|sequence_index=0|block_index=9|species=hg17|hg17_9_0
+aattttcccat---gagaactattcttcttttgtttt
+>rheMac2.chr3(+):165789492-165789526|sequence_index=0|block_index=9|species=rheMac2|rheMac2_9_0
+aattttcacat---aagaactattcttcttttgtttt
+>panTro1.chr6(+):129886562-129886596|sequence_index=0|block_index=9|species=panTro1|panTro1_9_0
+aattttcccgt---gagaactattcttcttttgtttt
+>canFam2.chr14(-):11089108-11089143|sequence_index=0|block_index=9|species=canFam2|canFam2_9_0
+aatggtcatgt--ccataactattcttcttttatttt
+>dasNov1.scaffold_256527(+):1401-1433|sequence_index=0|block_index=9|species=dasNov1|dasNov1_9_0
+aattttcacatatcacgaagtatttttttttt-----
+
diff -r eba44fc830bf -r c3b40f23a0e0 test-data/closest_features_either.interval
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closest_features_either.interval	Wed Sep 09 14:24:11 2009 -0400
@@ -0,0 +1,424 @@
+chr22	30128507	30133507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30136507	30141507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30132507	30137507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30140507	30145507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30136507	30141507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30128507	30133507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30140507	30145507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30132507	30137507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30144507	30149507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30136507	30141507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30148507	30153507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30140507	30145507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30152507	30157507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30144507	30149507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30156507	30161507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30148507	30153507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30160507	30165507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30152507	30157507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30164507	30169507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30156507	30161507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30168507	30173507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30160507	30165507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30172507	30177507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30164507	30169507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30176507	30181507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30168507	30173507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30180507	30185507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30172507	30177507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30184507	30189507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30176507	30181507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30188507	30193507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30180507	30185507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30192507	30197507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30184507	30189507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30196507	30201507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30188507	30193507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30200507	30205507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30192507	30197507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30204507	30209507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30196507	30201507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30208507	30213507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30200507	30205507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30212507	30217507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30204507	30209507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30216507	30221507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30208507	30213507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30220507	30225507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30212507	30217507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30224507	30229507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30216507	30221507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30228507	30233507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30220507	30225507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30232507	30237507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30224507	30229507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30236507	30241507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30228507	30233507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30240507	30245507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30232507	30237507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30244507	30249507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30236507	30241507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30248507	30253507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30240507	30245507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30252507	30257507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30244507	30249507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30256507	30261507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30248507	30253507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30260507	30265507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30252507	30257507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30264507	30269507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30256507	30261507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30268507	30273507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30260507	30265507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30272507	30277507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30264507	30269507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30276507	30281507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30268507	30273507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30280507	30285507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30272507	30277507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30284507	30289507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30276507	30281507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30288507	30293507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30280507	30285507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30292507	30297507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30284507	30289507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30296507	30301507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30288507	30293507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30300507	30305507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30292507	30297507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30304507	30309507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30296507	30301507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30308507	30313507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30300507	30305507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30312507	30317507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30304507	30309507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30316507	30321507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30308507	30313507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30320507	30325507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30312507	30317507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30324507	30329507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30316507	30321507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30328507	30333507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30320507	30325507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30332507	30337507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30324507	30329507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30336507	30341507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30328507	30333507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30340507	30345507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30332507	30337507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30344507	30349507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30336507	30341507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30348507	30353507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30340507	30345507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30352507	30357507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30344507	30349507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30356507	30361507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30348507	30353507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30360507	30365507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30352507	30357507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30364507	30369507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30356507	30361507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30368507	30373507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30360507	30365507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30372507	30377507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30364507	30369507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30376507	30381507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30368507	30373507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30380507	30385507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30372507	30377507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30384507	30389507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30376507	30381507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30388507	30393507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30380507	30385507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30392507	30397507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30384507	30389507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30396507	30401507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30388507	30393507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30400507	30405507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30392507	30397507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30404507	30409507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30396507	30401507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30408507	30413507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30400507	30405507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30412507	30417507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30404507	30409507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30416507	30421507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30408507	30413507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30420507	30425507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30412507	30417507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30424507	30429507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30416507	30421507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30428507	30433507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30420507	30425507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30432507	30437507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30424507	30429507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30436507	30441507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30428507	30433507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30440507	30445507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30432507	30437507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30444507	30449507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30436507	30441507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30448507	30453507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30440507	30445507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30452507	30457507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30444507	30449507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30456507	30461507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30448507	30453507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30460507	30465507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30452507	30457507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30464507	30469507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30456507	30461507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30468507	30473507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30460507	30465507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30472507	30477507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30464507	30469507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30476507	30481507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30468507	30473507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30480507	30485507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30472507	30477507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30484507	30489507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30476507	30481507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30488507	30493507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30480507	30485507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30492507	30497507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30484507	30489507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30496507	30501507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30488507	30493507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30500507	30505507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30492507	30497507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30504507	30509507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30496507	30501507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30508507	30513507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30500507	30505507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30512507	30517507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30504507	30509507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30516507	30521507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30508507	30513507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30520507	30525507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30512507	30517507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30524507	30529507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30516507	30521507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30528507	30533507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30520507	30525507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30532507	30537507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30524507	30529507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30536507	30541507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30528507	30533507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30540507	30545507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30532507	30537507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30544507	30549507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30536507	30541507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30548507	30553507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30540507	30545507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30552507	30557507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30544507	30549507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30556507	30561507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30548507	30553507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30560507	30565507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30552507	30557507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30564507	30569507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30556507	30561507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30568507	30573507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30560507	30565507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30572507	30577507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30564507	30569507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30576507	30581507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30568507	30573507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30580507	30585507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30572507	30577507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30584507	30589507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30576507	30581507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30588507	30593507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30580507	30585507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30592507	30597507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30584507	30589507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30596507	30601507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30588507	30593507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30600507	30605507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30592507	30597507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30604507	30609507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30596507	30601507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30608507	30613507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30600507	30605507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30612507	30617507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30604507	30609507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30616507	30621507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30608507	30613507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30620507	30625507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30612507	30617507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30624507	30629507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30616507	30621507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30628507	30633507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30620507	30625507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30632507	30637507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30624507	30629507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30636507	30641507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30628507	30633507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30640507	30645507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30632507	30637507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30644507	30649507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30636507	30641507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30648507	30653507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30640507	30645507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30652507	30657507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30644507	30649507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30656507	30661507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30648507	30653507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30660507	30665507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30652507	30657507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30664507	30669507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30656507	30661507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30668507	30673507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30660507	30665507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30672507	30677507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30664507	30669507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30676507	30681507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30668507	30673507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30680507	30685507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30672507	30677507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30684507	30689507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30676507	30681507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30688507	30693507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30680507	30685507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30692507	30697507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30684507	30689507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30696507	30701507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30688507	30693507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30700507	30705507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30692507	30697507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30704507	30709507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30696507	30701507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30708507	30713507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30700507	30705507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30712507	30717507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30704507	30709507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30716507	30721507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30708507	30713507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30720507	30725507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30712507	30717507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30724507	30729507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30716507	30721507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30728507	30733507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30720507	30725507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30732507	30737507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30724507	30729507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30736507	30741507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30728507	30733507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30740507	30745507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30732507	30737507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30744507	30749507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30736507	30741507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30748507	30753507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30740507	30745507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30752507	30757507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30744507	30749507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30756507	30761507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30748507	30753507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30760507	30765507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30752507	30757507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30764507	30769507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30756507	30761507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30768507	30773507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30760507	30765507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30772507	30777507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30764507	30769507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30776507	30781507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30768507	30773507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30780507	30785507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30772507	30777507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30784507	30789507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30776507	30781507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30788507	30793507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30780507	30785507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30792507	30797507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30784507	30789507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30796507	30801507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30788507	30793507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30800507	30805507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30792507	30797507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30804507	30809507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30796507	30801507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30808507	30813507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30800507	30805507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30812507	30817507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30804507	30809507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30816507	30821507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30808507	30813507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30820507	30825507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30812507	30817507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30824507	30829507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30816507	30821507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30828507	30833507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30820507	30825507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30832507	30837507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30824507	30829507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30836507	30841507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30828507	30833507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30840507	30845507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30832507	30837507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30844507	30849507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30836507	30841507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30848507	30853507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30840507	30845507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30852507	30857507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30844507	30849507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30856507	30861507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30848507	30853507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30860507	30865507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30852507	30857507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30864507	30869507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30856507	30861507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30868507	30873507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30860507	30865507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30872507	30877507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30864507	30869507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30876507	30881507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30868507	30873507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30880507	30885507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30872507	30877507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30884507	30889507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30876507	30881507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30888507	30893507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30880507	30885507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30892507	30897507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30884507	30889507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30896507	30901507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30888507	30893507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30900507	30905507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30892507	30897507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30904507	30909507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30896507	30901507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30908507	30913507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30900507	30905507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30912507	30917507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30904507	30909507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30916507	30921507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30908507	30913507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30920507	30925507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30912507	30917507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30924507	30929507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30916507	30921507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30928507	30933507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30920507	30925507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30932507	30937507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30924507	30929507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30936507	30941507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30928507	30933507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30940507	30945507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30932507	30937507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30944507	30949507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30936507	30941507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30948507	30953507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30940507	30945507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30952507	30957507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30944507	30949507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30956507	30961507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30948507	30953507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30960507	30965507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30952507	30957507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30964507	30969507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30956507	30961507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30968507	30973507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30960507	30965507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30972507	30977507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30964507	30969507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30976507	30981507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30968507	30973507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30980507	30985507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30972507	30977507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30984507	30989507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30976507	30981507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30988507	30993507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30980507	30985507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30992507	30997507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30984507	30989507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	30996507	31001507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30988507	30993507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31000507	31005507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30992507	30997507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31004507	31009507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	30996507	31001507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31008507	31013507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31000507	31005507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31012507	31017507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31004507	31009507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31016507	31021507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31008507	31013507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31020507	31025507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31012507	31017507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31024507	31029507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31016507	31021507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31028507	31033507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31020507	31025507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31032507	31037507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31024507	31029507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31036507	31041507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31028507	31033507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31040507	31045507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31032507	31037507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31044507	31049507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31036507	31041507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31048507	31053507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31040507	31045507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31052507	31057507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31044507	31049507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31056507	31061507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31048507	31053507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31060507	31065507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31052507	31057507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31064507	31069507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31056507	31061507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31068507	31073507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31060507	31065507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31072507	31077507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31064507	31069507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31076507	31081507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31068507	31073507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31080507	31085507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31072507	31077507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31084507	31089507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31076507	31081507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31088507	31093507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31080507	31085507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31092507	31097507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31084507	31089507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31096507	31101507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31088507	31093507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31100507	31105507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31092507	31097507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31104507	31109507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31096507	31101507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31108507	31113507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31100507	31105507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31112507	31117507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31104507	31109507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31116507	31121507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31108507	31113507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31120507	31125507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31112507	31117507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31124507	31129507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31116507	31121507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31128507	31133507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31120507	31125507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31132507	31137507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31124507	31129507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31136507	31141507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31128507	31133507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31140507	31145507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31132507	31137507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31144507	31149507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31136507	31141507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31148507	31153507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31140507	31145507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31152507	31157507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31144507	31149507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31156507	31161507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31148507	31153507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31160507	31165507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31152507	31157507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31164507	31169507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31156507	31161507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31168507	31173507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31160507	31165507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31172507	31177507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31164507	31169507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31176507	31181507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31168507	31173507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31180507	31185507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31172507	31177507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31184507	31189507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31176507	31181507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31188507	31193507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31180507	31185507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31192507	31197507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31184507	31189507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31196507	31201507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31188507	31193507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31200507	31205507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31192507	31197507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31204507	31209507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31196507	31201507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31208507	31213507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31200507	31205507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31212507	31217507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31204507	31209507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31216507	31221507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31208507	31213507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31220507	31225507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31212507	31217507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+
+chr22	31224507	31229507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+	chr22	31216507	31221507	uc003bnx.1_cds_2_0_chr22_29227_f	0	+

    

[galaxy-dev] [hg] galaxy 2670: Automated merge with http://bitbucket.org/gala...

Greg Von Kuster