details: http://www.bx.psu.edu/hg/galaxy/rev/c3b40f23a0e0 changeset: 2670:c3b40f23a0e0 user: James Taylor james@jamestaylor.org date: Wed Sep 09 14:24:11 2009 -0400 description: Automated merge with http://bitbucket.org/galaxy/galaxy-central/
2 file(s) affected in this change:
lib/galaxy/model/__init__.py templates/dataset/edit_attributes.mako
diffs (truncated from 7595 to 3000 lines):
diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_fasta_converter.py --- a/lib/galaxy/datatypes/converters/maf_to_fasta_converter.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/datatypes/converters/maf_to_fasta_converter.py Wed Sep 09 14:24:11 2009 -0400 @@ -14,12 +14,15 @@ input_name = sys.argv.pop(1) out = open( output_name, 'w' ) count = 0 - for count, maf in enumerate( bx.align.maf.Reader( open( input_name, 'r' ) ) ): - for c in maf.components: - spec, chrom = bx.align.maf.src_split( c.src ) - if not spec or not chrom: - spec = chrom = c.src - out.write( "%s\n" % maf_utilities.get_fasta_header( c, suffix = "%s_%i" % ( spec, count ) ) ) + for count, block in enumerate( bx.align.maf.Reader( open( input_name, 'r' ) ) ): + spec_counts = {} + for c in block.components: + spec, chrom = maf_utilities.src_split( c.src ) + if spec not in spec_counts: + spec_counts[ spec ] = 0 + else: + spec_counts[ spec ] += 1 + out.write( "%s\n" % maf_utilities.get_fasta_header( c, { 'block_index' : count, 'species' : spec, 'sequence_index' : spec_counts[ spec ] }, suffix = "%s_%i_%i" % ( spec, count, spec_counts[ spec ] ) ) ) out.write( "%s\n" % c.text ) out.write( "\n" ) out.close() diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_fasta_converter.xml --- a/lib/galaxy/datatypes/converters/maf_to_fasta_converter.xml Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/datatypes/converters/maf_to_fasta_converter.xml Wed Sep 09 14:24:11 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="CONVERTER_maf_to_fasta_0" name="Convert MAF to Fasta"> +<tool id="CONVERTER_maf_to_fasta_0" name="Convert MAF to Fasta" version="1.0.1"> <!-- <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> --> <command interpreter="python">maf_to_fasta_converter.py $output1 $input1</command> <inputs> diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_interval_converter.py --- a/lib/galaxy/datatypes/converters/maf_to_interval_converter.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/datatypes/converters/maf_to_interval_converter.py Wed Sep 09 14:24:11 2009 -0400 @@ -4,7 +4,8 @@ import sys from galaxy import eggs import pkg_resources; pkg_resources.require( "bx-python" ) -import bx.align.maf +import bx.align.maf +from galaxy.tools.util import maf_utilities
assert sys.version_info[:2] >= ( 2, 4 )
@@ -17,15 +18,15 @@ #write interval header line out.write( "#chrom\tstart\tend\tstrand\n" ) try: - for maf in bx.align.maf.Reader( open(input_name, 'r') ): - c = maf.get_component_by_src_start(species) - if c is not None: - out.write( "%s\t%i\t%i\t%s\n" % (bx.align.src_split(c.src)[-1], c.get_forward_strand_start(), c.get_forward_strand_end(), c.strand) ) - count += 1 + for block in bx.align.maf.Reader( open( input_name, 'r' ) ): + for c in maf_utilities.iter_components_by_src_start( block, species ): + if c is not None: + out.write( "%s\t%i\t%i\t%s\n" % ( bx.align.src_split( c.src )[-1], c.get_forward_strand_start(), c.get_forward_strand_end(), c.strand ) ) + count += 1 except Exception, e: print >> sys.stderr, "There was a problem processing your input: %s" % e out.close() - print "%i MAF blocks converted to Genomic Intervals for species %s." % (count, species) + print "%i MAF blocks converted to Genomic Intervals for species %s." % ( count, species )
if __name__ == "__main__": __main__() diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/converters/maf_to_interval_converter.xml --- a/lib/galaxy/datatypes/converters/maf_to_interval_converter.xml Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/datatypes/converters/maf_to_interval_converter.xml Wed Sep 09 14:24:11 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="CONVERTER_maf_to_interval_0" name="Convert MAF to Genomic Intervals"> +<tool id="CONVERTER_maf_to_interval_0" name="Convert MAF to Genomic Intervals" version="1.0.1"> <!-- <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> --> <command interpreter="python">maf_to_interval_converter.py $output1 $input1 ${input1.metadata.dbkey}</command> <inputs> diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/datatypes/sequence.py --- a/lib/galaxy/datatypes/sequence.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/datatypes/sequence.py Wed Sep 09 14:24:11 2009 -0400 @@ -22,7 +22,7 @@ pass
class Alignment( Sequence ): - """Class describing an alignmnet""" + """Class describing an alignment"""
"""Add metadata elements""" MetadataElement( name="species", desc="Species", default=[], param=metadata.SelectParameter, multiple=True, readonly=True, no_value=None ) @@ -316,6 +316,78 @@ import bx.align.maf except: pass +#trying to import maf_utilities here throws an ImportError due to a circular import between jobs and tools: +#from galaxy.tools.util.maf_utilities import build_maf_index_species_chromosomes +#Traceback (most recent call last): +# File "./scripts/paster.py", line 27, in <module> +# command.run() +# File "build/bdist.solaris-2.11-i86pc/egg/paste/script/command.py", line 78, in run +# File "build/bdist.solaris-2.11-i86pc/egg/paste/script/command.py", line 117, in invoke +# File "build/bdist.solaris-2.11-i86pc/egg/paste/script/command.py", line 212, in run +# File "build/bdist.solaris-2.11-i86pc/egg/paste/script/serve.py", line 227, in command +# File "build/bdist.solaris-2.11-i86pc/egg/paste/script/serve.py", line 250, in loadapp +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 193, in loadapp +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 213, in loadobj +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 237, in loadcontext +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 267, in _loadconfig +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 397, in get_context +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 439, in _context_from_explicit +# File "build/bdist.solaris-2.11-i86pc/egg/paste/deploy/loadwsgi.py", line 18, in import_string +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/pkg_resources.py", line 1912, in load +# entry = __import__(self.module_name, globals(),globals(), ['__name__']) +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/web/buildapp.py", line 18, in <module> +# from galaxy import config, jobs, util, tools +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/jobs/__init__.py", line 3, in <module> +# from galaxy import util, model +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/model/__init__.py", line 13, in <module> +# import galaxy.datatypes.registry +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/datatypes/registry.py", line 6, in <module> +# import data, tabular, interval, images, sequence, qualityscore, genetics, xml, coverage, tracks, chrominfo +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/datatypes/sequence.py", line 344, in <module> +# from galaxy.tools.util.maf_utilities import build_maf_index_species_chromosomes +# File "/afs/bx.psu.edu/home/dan/galaxy/central/lib/galaxy/tools/__init__.py", line 15, in <module> +# from galaxy import util, jobs, model +#ImportError: cannot import name jobs +#so we'll copy and paste for now...terribly icky +#*** ANYCHANGE TO THIS METHOD HERE OR IN maf_utilities MUST BE PROPAGATED *** +def COPIED_build_maf_index_species_chromosomes( filename, index_species = None ): + species = [] + species_chromosomes = {} + indexes = bx.interval_index_file.Indexes() + try: + maf_reader = bx.align.maf.Reader( open( filename ) ) + while True: + pos = maf_reader.file.tell() + block = maf_reader.next() + if block is None: break + for c in block.components: + spec = c.src + chrom = None + if "." in spec: + spec, chrom = spec.split( ".", 1 ) + if spec not in species: + species.append( spec ) + species_chromosomes[spec] = [] + if chrom and chrom not in species_chromosomes[spec]: + species_chromosomes[spec].append( chrom ) + if index_species is None or spec in index_species: + forward_strand_start = c.forward_strand_start + forward_strand_end = c.forward_strand_end + try: + forward_strand_start = int( forward_strand_start ) + forward_strand_end = int( forward_strand_end ) + except ValueError: + continue #start and end are not integers, can't add component to index, goto next component + #this likely only occurs when parse_e_rows is True? + #could a species exist as only e rows? should the + if forward_strand_end > forward_strand_start: + #require positive length; i.e. certain lines have start = end = 0 and cannot be indexed + indexes.add( c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size ) + except Exception, e: + #most likely a bad MAF + log.debug( 'Building MAF index on %s failed: %s' % ( filename, e ) ) + return ( None, [], {} ) + return ( indexes, species, species_chromosomes )
class Maf( Alignment ): """Class describing a Maf alignment""" @@ -333,38 +405,8 @@ Parses and sets species, chromosomes, index from MAF file. """ #these metadata values are not accessable by users, always overwrite + indexes, species, species_chromosomes = COPIED_build_maf_index_species_chromosomes( dataset.file_name )
- try: - maf_reader = bx.align.maf.Reader( open( dataset.file_name ) ) - except: - return #not a maf file - species = [] - species_chromosomes = {} - indexes = bx.interval_index_file.Indexes() - while True: - pos = maf_reader.file.tell() - block = maf_reader.next() - if block is None: break - for c in block.components: - spec = c.src - chrom = None - if "." in spec: - spec, chrom = spec.split( ".", 1 ) - if spec not in species: - species.append(spec) - species_chromosomes[spec] = [] - if chrom and chrom not in species_chromosomes[spec]: - species_chromosomes[spec].append( chrom ) - forward_strand_start = c.forward_strand_start - forward_strand_end = c.forward_strand_end - try: - forward_strand_start = int( forward_strand_start ) - forward_strand_end = int( forward_strand_end ) - except ValueError: - continue #start and end are not integers, can't add component to index, goto next component - if forward_strand_end > forward_strand_start: - #require positive length; i.e. certain lines have start = end = 0 and cannot be indexed - indexes.add( c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size ) dataset.metadata.species = species #only overwrite the contents if our newly determined chromosomes don't match stored chrom_file = dataset.metadata.species_chromosomes diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/model/__init__.py Wed Sep 09 14:24:11 2009 -0400 @@ -709,9 +709,9 @@ folder.order_id = self.item_count self.item_count += 1 def get_info_association( self, restrict=False ): - # If restrict is True, we will return this folder's info_association whether it - # exists or not. If restrict is False, we'll return the next available info_association - # in the inheritable hierarchy + # If restrict is True, we will return this folder's info_association, not inheriting. + # If restrict is False, we'll return the next available info_association in the + # inheritable hierarchy if self.info_association: return self.info_association[0] if restrict: @@ -721,9 +721,6 @@ if self.library_root: return self.library_root[0].get_info_association() return None - @property - def active_components( self ): - return list( self.active_folders ) + list( self.active_library_datasets ) @property def active_library_datasets( self ): # This needs to be a list @@ -736,10 +733,6 @@ def active_datasets( self ): # This needs to be a list return [ ld.library_dataset_dataset_association.dataset for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] - @property #make this a relation - def activatable_folders( self ): - # This needs to be a list - return [ folder for folder in self.folders if not folder.purged ]
class LibraryDataset( object ): # This class acts as a proxy to the currently selected LDDA @@ -1062,17 +1055,11 @@ return s return False def submitted(self): - if self.state == self.states.SUBMITTED: - return True - return False + return self.state == self.states.SUBMITTED def unsubmitted(self): - if self.state == self.states.UNSUBMITTED: - return True - return False + return self.state == self.states.UNSUBMITTED def complete(self): - if self.state == self.states.COMPLETE: - return True - return False + return self.state == self.states.COMPLETE
class RequestType( object ): def __init__(self, name=None, desc=None, request_form=None, sample_form=None): diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/model/mapping.py --- a/lib/galaxy/model/mapping.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/model/mapping.py Wed Sep 09 14:24:11 2009 -0400 @@ -233,10 +233,10 @@ Column( "id", Integer, primary_key=True ), Column( "library_dataset_dataset_association_id", Integer, ForeignKey( "library_dataset_dataset_association.id", use_alter=True, name="library_dataset_dataset_association_id_fk" ), nullable=True, index=True ),#current version of dataset, if null, there is not a current version selected Column( "folder_id", Integer, ForeignKey( "library_folder.id" ), index=True ), - Column( "order_id", Integer ), + Column( "order_id", Integer ), #not currently being used, but for possible future use Column( "create_time", DateTime, default=now ), Column( "update_time", DateTime, default=now, onupdate=now ), - Column( "name", TrimmedString( 255 ), key="_name" ), #when not None/null this will supercede display in library (but not when imported into user's history?) + Column( "name", TrimmedString( 255 ), key="_name", index=True ), #when not None/null this will supercede display in library (but not when imported into user's history?) Column( "info", TrimmedString( 255 ), key="_info" ), #when not None/null this will supercede display in library (but not when imported into user's history?) Column( "deleted", Boolean, index=True, default=False ) )
@@ -248,7 +248,7 @@ Column( "update_time", DateTime, default=now, onupdate=now ), Column( "copied_from_history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id", use_alter=True, name='history_dataset_association_dataset_id_fkey' ), nullable=True ), Column( "copied_from_library_dataset_dataset_association_id", Integer, ForeignKey( "library_dataset_dataset_association.id", use_alter=True, name='library_dataset_dataset_association_id_fkey' ), nullable=True ), - Column( "name", TrimmedString( 255 ) ), + Column( "name", TrimmedString( 255 ), index=True ), Column( "info", TrimmedString( 255 ) ), Column( "blurb", TrimmedString( 255 ) ), Column( "peek" , TEXT ), @@ -276,9 +276,9 @@ Column( "parent_id", Integer, ForeignKey( "library_folder.id" ), nullable = True, index=True ), Column( "create_time", DateTime, default=now ), Column( "update_time", DateTime, default=now, onupdate=now ), - Column( "name", TEXT ), + Column( "name", TEXT, index=True ), Column( "description", TEXT ), - Column( "order_id", Integer ), + Column( "order_id", Integer ), #not currently being used, but for possible future use Column( "item_count", Integer ), Column( "deleted", Boolean, index=True, default=False ), Column( "purged", Boolean, index=True, default=False ), @@ -823,15 +823,16 @@ folders=relation( LibraryFolder, primaryjoin=( LibraryFolder.table.c.parent_id == LibraryFolder.table.c.id ), + order_by=asc( LibraryFolder.table.c.name ), backref=backref( "parent", primaryjoin=( LibraryFolder.table.c.parent_id == LibraryFolder.table.c.id ), remote_side=[LibraryFolder.table.c.id] ) ), active_folders=relation( LibraryFolder, primaryjoin=( ( LibraryFolder.table.c.parent_id == LibraryFolder.table.c.id ) & ( not_( LibraryFolder.table.c.deleted ) ) ), - order_by=asc( LibraryFolder.table.c.order_id ), + order_by=asc( LibraryFolder.table.c.name ), lazy=True, #"""sqlalchemy.exceptions.ArgumentError: Error creating eager relationship 'active_folders' on parent class '<class 'galaxy.model.LibraryFolder'>' to child class '<class 'galaxy.model.LibraryFolder'>': Cant use eager loading on a self referential relationship.""" viewonly=True ), datasets=relation( LibraryDataset, primaryjoin=( ( LibraryDataset.table.c.folder_id == LibraryFolder.table.c.id ) ), - order_by=asc( LibraryDataset.table.c.order_id ), + order_by=asc( LibraryDataset.table.c._name ), lazy=False, viewonly=True ) ) ) diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/model/migrate/versions/0017_library_item_indexes.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0017_library_item_indexes.py Wed Sep 09 14:24:11 2009 -0400 @@ -0,0 +1,53 @@ +""" +This script adds 3 indexes to table columns: library_folder.name, +library_dataset.name, library_dataset_dataset_association.name. +""" +from sqlalchemy import * +from sqlalchemy.orm import * +from migrate import * +import sys, logging + +log = logging.getLogger( __name__ ) +log.setLevel(logging.DEBUG) +handler = logging.StreamHandler( sys.stdout ) +format = "%(name)s %(levelname)s %(asctime)s %(message)s" +formatter = logging.Formatter( format ) +handler.setFormatter( formatter ) +log.addHandler( handler ) + +metadata = MetaData( migrate_engine ) +db_session = scoped_session( sessionmaker( bind=migrate_engine, autoflush=False, transactional=False ) ) +LibraryFolder_table = Table( "library_folder", metadata, autoload=True ) +LibraryDatasetDatasetAssociation_table = Table( "library_dataset_dataset_association", metadata, autoload=True ) +LibraryDataset_table = Table( "library_dataset", metadata, autoload=True ) + +def display_migration_details(): + print "========================================" + print "This script adds 3 indexes to table columns: library_folder.name," + print "library_dataset.name, library_dataset_dataset_association.name." + print "========================================" + +def upgrade(): + display_migration_details() + # Load existing tables + metadata.reflect() + # Add 1 index to the library_folder table + i = Index( 'ix_library_folder_name', LibraryFolder_table.c.name ) + try: + i.create() + except Exception, e: + log.debug( "Adding index 'ix_library_folder_name' to library_folder table failed: %s" % ( str( e ) ) ) + # Add 1 index to the library_dataset_dataset_association table + i = Index( 'ix_library_dataset_dataset_association_name', LibraryDatasetDatasetAssociation_table.c.name ) + try: + i.create() + except Exception, e: + log.debug( "Adding index 'ix_library_dataset_dataset_association_name' to library_dataset_dataset_association table failed: %s" % ( str( e ) ) ) + # Add 1 index to the library_dataset table + i = Index( 'ix_library_dataset_name', LibraryDataset_table.c.name ) + try: + i.create() + except Exception, e: + log.debug( "Adding index 'ix_library_dataset_name' to library_dataset table failed: %s" % ( str( e ) ) ) +def downgrade(): + log.debug( "Downgrade is not possible." ) diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/security/__init__.py --- a/lib/galaxy/security/__init__.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/security/__init__.py Wed Sep 09 14:24:11 2009 -0400 @@ -33,11 +33,19 @@ def get_actions( self ): """Get all permitted actions as a list of Action objects""" return self.permitted_actions.__dict__.values() - def allow_action( self, user, roles, action, **kwd ): - raise 'No valid method of checking action (%s) on %s for user %s.' % ( action, kwd, user ) def get_item_action( self, action, item ): raise 'No valid method of retrieving action (%s) for item %s.' % ( action, item ) def guess_derived_permissions_for_datasets( self, datasets = [] ): + raise "Unimplemented Method" + def can_access_dataset( self, roles, dataset ): + raise "Unimplemented Method" + def can_manage_dataset( self, roles, dataset ): + raise "Unimplemented Method" + def can_add_library_item( self, user, roles, item ): + raise "Unimplemented Method" + def can_modify_library_item( self, user, roles, item ): + raise "Unimplemented Method" + def can_manage_library_item( self, user, roles, item ): raise "Unimplemented Method" def associate_components( self, **kwd ): raise 'No valid method of associating provided components: %s' % kwd @@ -89,62 +97,44 @@ to allow migration toward a more SQLAlchemy 0.4 style of use. """ return self.model.context.current - def allow_action( self, user, roles, action, **kwd ): - if 'dataset' in kwd: - return self.allow_dataset_action( user, roles, action, kwd[ 'dataset' ] ) - elif 'library_item' in kwd: - return self.allow_library_item_action( user, roles, action, kwd[ 'library_item' ] ) - raise 'No valid method of checking action (%s) for user %s using kwd %s' % ( action, str( user ), str( kwd ) ) - def allow_dataset_action( self, user, roles, action, dataset ): - """Returns true when user has permission to perform an action""" - if not user: - if action == self.permitted_actions.DATASET_ACCESS and action.action not in [ dp.action for dp in dataset.actions ]: - # anons only get access, and only if there are no roles required for the access action - # Other actions (or if the dataset has roles defined for the access action) fall through - # to the false below - return True - elif action.action not in [ dp.action for dp in dataset.actions ]: - if action.model == 'restrict': - # Implicit access to restrict-style actions if the dataset does not have the action - # Grant style actions fall through to the false below - return True - else: - perms = self.get_dataset_permissions( dataset ) - if action in perms.keys(): - # The filter() returns a list of the dataset's role ids of which the user is not a member, - # so an empty list means the user has all of the required roles. - if not filter( lambda x: x not in roles, [ r for r in perms[ action ] ] ): - # User has all of the roles required to perform the action - return True - # The user is missing at least one required role - return False - def allow_library_item_action( self, user, roles, action, library_item ): + def allow_dataset_action( self, roles, action, dataset ): + """ + Returns true when user has permission to perform an action on an + instance of Dataset. + """ + dataset_action = self.get_item_action( action, dataset ) + if dataset_action is None: + return action.model == 'restrict' + return dataset_action.role in roles + def can_access_dataset( self, roles, dataset ): + return self.allow_dataset_action( roles, self.permitted_actions.DATASET_ACCESS, dataset ) + def can_manage_dataset( self, roles, dataset ): + return self.allow_dataset_action( roles, self.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset ) + def allow_library_item_action( self, user, roles, action, item ): + """ + Method for checking a permission for the current user to perform a + specific library action on a library item, which must be one of: + Library, LibraryFolder, LibraryDataset, LibraryDatasetDatasetAssociation + """ if user is None: # All permissions are granted, so non-users cannot have permissions return False - if action.model == 'grant': - # Check to see if user has access to any of the roles - allowed_role_assocs = [] - for item_class, permission_class in self.library_item_assocs: - if isinstance( library_item, item_class ): - if permission_class == self.model.LibraryPermissions: - allowed_role_assocs = permission_class.filter_by( action=action.action, library_id=library_item.id ).all() - elif permission_class == self.model.LibraryFolderPermissions: - allowed_role_assocs = permission_class.filter_by( action=action.action, library_folder_id=library_item.id ).all() - elif permission_class == self.model.LibraryDatasetPermissions: - allowed_role_assocs = permission_class.filter_by( action=action.action, library_dataset_id=library_item.id ).all() - elif permission_class == self.model.LibraryDatasetDatasetAssociationPermissions: - allowed_role_assocs = permission_class.filter_by( action=action.action, library_dataset_dataset_association_id=library_item.id ).all() - for allowed_role_assoc in allowed_role_assocs: - if allowed_role_assoc.role in roles: - return True + # Check to see if user has access to any of the roles associated with action + item_action = self.get_item_action( action, item ) + if item_action is None: + # All permissions are granted, so item must have action return False - else: - raise 'Unimplemented model (%s) specified for action (%s)' % ( action.model, action.action ) + return item_action.role in roles + def can_add_library_item( self, user, roles, item ): + return self.allow_library_item_action( user, roles, self.permitted_actions.LIBRARY_ADD, item ) + def can_modify_library_item( self, user, roles, item ): + return self.allow_library_item_action( user, roles, self.permitted_actions.LIBRARY_MODIFY, item ) + def can_manage_library_item( self, user, roles, item ): + return self.allow_library_item_action( user, roles, self.permitted_actions.LIBRARY_MANAGE, item ) def get_item_action( self, action, item ): # item must be one of: Dataset, Library, LibraryFolder, LibraryDataset, LibraryDatasetDatasetAssociation for permission in item.actions: - if permission.action == action: + if permission.action == action.action: return permission return None def guess_derived_permissions_for_datasets( self, datasets=[] ): @@ -276,10 +266,7 @@ if [ assoc for assoc in dataset.history_associations if assoc.history not in user.histories ]: # Don't change permissions on a dataset associated with a history not owned by the user continue - if bypass_manage_permission or self.allow_action( user, - user.all_roles(), - self.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=dataset ): + if bypass_manage_permission or self.can_manage_dataset( user.all_roles(), dataset ): self.set_all_dataset_permissions( dataset, permissions ) def history_get_default_permissions( self, history ): permissions = {} @@ -291,7 +278,10 @@ permissions[ action ] = [ dhp.role ] return permissions def set_all_dataset_permissions( self, dataset, permissions={} ): - # Set new permissions on a dataset, eliminating all current permissions + """ + Set new permissions on a dataset, eliminating all current permissions + permissions looks like: { Action : [ Role, Role ] } + """ # Delete all of the current permissions on the dataset # TODO: If setting ACCESS permission, at least 1 user must have every role associated with this dataset, # or the dataset is inaccessible. See admin/library_dataset_dataset_association() @@ -305,7 +295,10 @@ for dp in [ self.model.DatasetPermissions( action, dataset, role ) for role in roles ]: dp.flush() def set_dataset_permission( self, dataset, permission={} ): - # Set a specific permission on a dataset, leaving all other current permissions on the dataset alone + """ + Set a specific permission on a dataset, leaving all other current permissions on the dataset alone + permissions looks like: { Action : [ Role, Role ] } + """ # TODO: If setting ACCESS permission, at least 1 user must have every role associated with this dataset, # or the dataset is inaccessible. See admin/library_dataset_dataset_association() for action, roles in permission.items(): @@ -331,8 +324,11 @@ dp.delete() dp.flush() def get_dataset_permissions( self, dataset ): - if not isinstance( dataset, self.model.Dataset ): - dataset = dataset.dataset + """ + Return a dictionary containing the actions and associated roles on dataset. + The dictionary looks like: { Action : [ Role, Role ] } + dataset must be an instance of Dataset() + """ permissions = {} for dp in dataset.actions: action = self.get_action( dp.action ) @@ -423,18 +419,29 @@ else: raise 'Invalid class (%s) specified for target_library_item (%s)' % \ ( target_library_item.__class__, target_library_item.__class__.__name__ ) - def show_library_item( self, user, roles, library_item ): - if self.allow_action( user, roles, self.permitted_actions.LIBRARY_MODIFY, library_item=library_item ) or \ - self.allow_action( user, roles, self.permitted_actions.LIBRARY_MANAGE, library_item=library_item ) or \ - self.allow_action( user, roles, self.permitted_actions.LIBRARY_ADD, library_item=library_item ): - return True + def show_library_item( self, user, roles, library_item, actions_to_check, hidden_folder_ids='' ): + """ + This method must be sent an instance of Library() or LibraryFolder(). Recursive execution produces a + comma-separated string of folder ids whose folders do NOT meet the criteria for showing. Along with + the string, True is returned if the current user has permission to perform any 1 of actions_to_check + on library_item. Otherwise, cycle through all sub-folders in library_item until one is found that meets + this criteria, if it exists. + """ + for action in actions_to_check: + if self.allow_library_item_action( user, roles, action, library_item ): + return True, hidden_folder_ids if isinstance( library_item, self.model.Library ): - return self.show_library_item( user, roles, library_item.root_folder ) - elif isinstance( library_item, self.model.LibraryFolder ): - for folder in library_item.folders: - if self.show_library_item( user, roles, folder ): - return True - return False + return self.show_library_item( user, roles, library_item.root_folder, actions_to_check, hidden_folder_ids=hidden_folder_ids ) + if isinstance( library_item, self.model.LibraryFolder ): + for folder in library_item.active_folders: + can_show, hidden_folder_ids = self.show_library_item( user, roles, folder, actions_to_check, hidden_folder_ids=hidden_folder_ids ) + if can_show: + return True, hidden_folder_ids + if hidden_folder_ids: + hidden_folder_ids = '%s,%d' % ( hidden_folder_ids, folder.id ) + else: + hidden_folder_ids = '%d' % folder.id + return False, hidden_folder_ids def set_entity_user_associations( self, users=[], roles=[], groups=[], delete_existing_assocs=True ): for user in users: if delete_existing_assocs: @@ -482,12 +489,14 @@ if 'role' in kwd: return self.model.GroupRoleAssociation.filter_by( role_id = kwd['role'].id, group_id = kwd['group'].id ).first() raise 'No valid method of associating provided components: %s' % kwd - def check_folder_contents( self, user, roles, folder ): + def check_folder_contents( self, user, roles, folder, hidden_folder_ids='' ): """ - Return true if there are any datasets under 'folder' that are public or that the - user has access permission on. + This method must always be sent an instance of LibraryFolder(). Recursive execution produces a + comma-separated string of folder ids whose folders do NOT meet the criteria for showing. Along + with the string, True is returned if the current user has permission to access folder. Otherwise, + cycle through all sub-folders in folder until one is found that meets this criteria, if it exists. """ - action = self.permitted_actions.DATASET_ACCESS.action + action = self.permitted_actions.DATASET_ACCESS lddas = self.sa_session.query( self.model.LibraryDatasetDatasetAssociation ) \ .join( "library_dataset" ) \ .filter( self.model.LibraryDataset.folder == folder ) \ @@ -498,14 +507,19 @@ ldda_access = self.get_item_action( action, ldda.dataset ) if ldda_access is None: # Dataset is public - return True + return True, hidden_folder_ids if ldda_access.role in roles: # The current user has access permission on the dataset - return True + return True, hidden_folder_ids for sub_folder in folder.active_folders: - if self.check_folder_contents( user, roles, sub_folder ): - return True - return False + can_access, hidden_folder_ids = self.check_folder_contents( user, roles, sub_folder, hidden_folder_ids=hidden_folder_ids ) + if can_access: + return True, hidden_folder_ids + if hidden_folder_ids: + hidden_folder_ids = '%s,%d' % ( hidden_folder_ids, sub_folder.id ) + else: + hidden_folder_ids = '%d' % sub_folder.id + return False, hidden_folder_ids
class HostAgent( RBACAgent ): """ diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/tools/actions/__init__.py --- a/lib/galaxy/tools/actions/__init__.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/tools/actions/__init__.py Wed Sep 09 14:24:11 2009 -0400 @@ -48,10 +48,7 @@ assoc.flush() data = new_data user, roles = trans.get_user_and_roles() - if data and not trans.app.security_agent.allow_action( user, - roles, - data.permitted_actions.DATASET_ACCESS, - dataset=data.dataset ): + if data and not trans.app.security_agent.can_access_dataset( roles, data.dataset ): raise "User does not have permission to use a dataset (%s) provided for input." % data.id return data if isinstance( input, DataToolParameter ): @@ -267,10 +264,7 @@ user, roles = trans.get_user_and_roles() for name, dataset in inp_data.iteritems(): if dataset: - if not trans.app.security_agent.allow_action( user, - roles, - dataset.permitted_actions.DATASET_ACCESS, - dataset=dataset.dataset ): + if not trans.app.security_agent.can_access_dataset( roles, dataset.dataset ): raise "User does not have permission to use a dataset (%s) provided for input." % data.id job.add_input_dataset( name, dataset ) else: diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/tools/parameters/basic.py --- a/lib/galaxy/tools/parameters/basic.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/tools/parameters/basic.py Wed Sep 09 14:24:11 2009 -0400 @@ -1149,19 +1149,11 @@ hid = str( hda.hid ) if not hda.dataset.state in [galaxy.model.Dataset.states.ERROR, galaxy.model.Dataset.states.DISCARDED] and \ hda.visible and \ - trans.app.security_agent.allow_action( user, - roles, - hda.permitted_actions.DATASET_ACCESS, - dataset=hda.dataset ): + trans.app.security_agent.can_access_dataset( roles, hda.dataset ): # If we are sending data to an external application, then we need to make sure there are no roles - # associated with the dataset that restrict it's access from "public". We determine this by sending - # None as the user to the allow_action method. - if self.tool and self.tool.tool_type == 'data_destination': - if not trans.app.security_agent.allow_action( None, - None, - hda.permitted_actions.DATASET_ACCESS, - dataset=hda.dataset ): - continue + # associated with the dataset that restrict it's access from "public". + if self.tool and self.tool.tool_type == 'data_destination' and not trans.app.security_agent.dataset_is_public( hda.dataset ): + continue if self.options and hda.get_dbkey() != filter_value: continue if isinstance( hda.datatype, self.formats): @@ -1172,10 +1164,7 @@ if target_ext: if converted_dataset: hda = converted_dataset - if not trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda.dataset ): + if not trans.app.security_agent.can_access_dataset( roles, hda.dataset ): continue selected = ( value and ( hda in value ) ) field.add_option( "%s: (as %s) %s" % ( hid, target_ext, hda_name ), hda.id, selected ) diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/tools/util/maf_utilities.py --- a/lib/galaxy/tools/util/maf_utilities.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/tools/util/maf_utilities.py Wed Sep 09 14:24:11 2009 -0400 @@ -7,10 +7,41 @@ import bx.align.maf import bx.intervals import bx.interval_index_file -import sys, os, string, tempfile +import sys, os, string, tempfile +import logging +from copy import deepcopy
assert sys.version_info[:2] >= ( 2, 4 ) - + +log = logging.getLogger(__name__) + + +GAP_CHARS = [ '-' ] +SRC_SPLIT_CHAR = '.' + +def src_split( src ): + spec, chrom = bx.align.maf.src_split( src ) + if None in [ spec, chrom ]: + spec = chrom = src + return spec, chrom + +def src_merge( spec, chrom, contig = None ): + if None in [ spec, chrom ]: + spec = chrom = spec or chrom + return bx.align.maf.src_merge( spec, chrom, contig ) + +def get_species_in_block( block ): + species = [] + for c in block.components: + spec, chrom = src_split( c.src ) + if spec not in species: + species.append( spec ) + return species + +def tool_fail( msg = "Unknown Error" ): + print >> sys.stderr, "Fatal Error: %s" % msg + sys.exit() + #an object corresponding to a reference layered alignment class RegionAlignment( object ):
@@ -153,69 +184,187 @@ except: return build_maf_index( maf_file, species = species )
+#*** ANYCHANGE TO THIS METHOD HERE OR IN galaxy.datatypes.sequences MUST BE PROPAGATED *** +def build_maf_index_species_chromosomes( filename, index_species = None ): + species = [] + species_chromosomes = {} + indexes = bx.interval_index_file.Indexes() + try: + maf_reader = bx.align.maf.Reader( open( filename ) ) + while True: + pos = maf_reader.file.tell() + block = maf_reader.next() + if block is None: break + for c in block.components: + spec = c.src + chrom = None + if "." in spec: + spec, chrom = spec.split( ".", 1 ) + if spec not in species: + species.append( spec ) + species_chromosomes[spec] = [] + if chrom and chrom not in species_chromosomes[spec]: + species_chromosomes[spec].append( chrom ) + if index_species is None or spec in index_species: + forward_strand_start = c.forward_strand_start + forward_strand_end = c.forward_strand_end + try: + forward_strand_start = int( forward_strand_start ) + forward_strand_end = int( forward_strand_end ) + except ValueError: + continue #start and end are not integers, can't add component to index, goto next component + #this likely only occurs when parse_e_rows is True? + #could a species exist as only e rows? should the + if forward_strand_end > forward_strand_start: + #require positive length; i.e. certain lines have start = end = 0 and cannot be indexed + indexes.add( c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size ) + except Exception, e: + #most likely a bad MAF + log.debug( 'Building MAF index on %s failed: %s' % ( filename, e ) ) + return ( None, [], {} ) + return ( indexes, species, species_chromosomes )
#builds and returns ( index, index_filename ) for specified maf_file def build_maf_index( maf_file, species = None ): - indexes = bx.interval_index_file.Indexes() - try: - maf_reader = bx.align.maf.Reader( open( maf_file ) ) - # Need to be a bit tricky in our iteration here to get the 'tells' right - while True: - pos = maf_reader.file.tell() - block = maf_reader.next() - if block is None: break - for c in block.components: - if species is not None and c.src.split( "." )[0] not in species: - continue - indexes.add( c.src, c.forward_strand_start, c.forward_strand_end, pos ) + indexes, found_species, species_chromosomes = build_maf_index_species_chromosomes( maf_file, species ) + if indexes is not None: fd, index_filename = tempfile.mkstemp() out = os.fdopen( fd, 'w' ) indexes.write( out ) out.close() - return ( bx.align.maf.Indexed( maf_file, index_filename = index_filename, keep_open = True, parse_e_rows = False ), index_filename ) - except: - return ( None, None ) - -def chop_block_by_region( block, src, region, species = None, mincols = 0, force_strand = None ): - ref = block.get_component_by_src( src ) - #We want our block coordinates to be from positive strand - if ref.strand == "-": - block = block.reverse_complement() - ref = block.get_component_by_src( src ) + return ( bx.align.maf.Indexed( maf_file, index_filename = index_filename, keep_open = True, parse_e_rows = False ), index_filename ) + return ( None, None ) + +def component_overlaps_region( c, region ): + if c is None: return False + start, end = c.get_forward_strand_start(), c.get_forward_strand_end() + if region.start >= end or region.end <= start: + return False + return True + +def chop_block_by_region( block, src, region, species = None, mincols = 0 ): + # This chopping method was designed to maintain consistency with how start/end padding gaps have been working in Galaxy thus far: + # behavior as seen when forcing blocks to be '+' relative to src sequence (ref) and using block.slice_by_component( ref, slice_start, slice_end ) + # whether-or-not this is the 'correct' behavior is questionable, but this will at least maintain consistency + # comments welcome + slice_start = block.text_size #max for the min() + slice_end = 0 #min for the max() + old_score = block.score #save old score for later use + # We no longer assume only one occurance of src per block, so we need to check them all + for c in iter_components_by_src( block, src ): + if component_overlaps_region( c, region ): + if c.text is not None: + rev_strand = False + if c.strand == "-": + #We want our coord_to_col coordinates to be returned from positive stranded component + rev_strand = True + c = c.reverse_complement() + start = max( region.start, c.start ) + end = min( region.end, c.end ) + start = c.coord_to_col( start ) + end = c.coord_to_col( end ) + if rev_strand: + #need to orient slice coordinates to the original block direction + slice_len = end - start + end = len( c.text ) - start + start = end - slice_len + slice_start = min( start, slice_start ) + slice_end = max( end, slice_end ) + + if slice_start < slice_end: + block = block.slice( slice_start, slice_end ) + if block.text_size > mincols: + # restore old score, may not be accurate, but it is better than 0 for everything? + block.score = old_score + if species is not None: + block = block.limit_to_species( species ) + block.remove_all_gap_columns() + return block + return None
- #save old score here for later use - old_score = block.score - slice_start = max( region.start, ref.start ) - slice_end = min( region.end, ref.end ) - - #slice block by reference species at determined limits - block = block.slice_by_component( ref, slice_start, slice_end ) - - if block.text_size > mincols: - if ( force_strand is None and region.strand != ref.strand ) or ( force_strand is not None and force_strand != ref.strand ): - block = block.reverse_complement() - # restore old score, may not be accurate, but it is better than 0 for everything - block.score = old_score - if species is not None: - block = block.limit_to_species( species ) - block.remove_all_gap_columns() - return block - return None +def orient_block_by_region( block, src, region, force_strand = None ): + #loop through components matching src, + #make sure each of these components overlap region + #cache strand for each of overlaping regions + #if force_strand / region.strand not in strand cache, reverse complement + ### we could have 2 sequences with same src, overlapping region, on different strands, this would cause no reverse_complementing + strands = [ c.strand for c in iter_components_by_src( block, src ) if component_overlaps_region( c, region ) ] + if strands and ( force_strand is None and region.strand not in strands ) or ( force_strand is not None and force_strand not in strands ): + block = block.reverse_complement() + return block + +def get_oriented_chopped_blocks_for_region( index, src, region, species = None, mincols = 0, force_strand = None ): + for block, idx, offset in get_oriented_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols, force_strand ): + yield block +def get_oriented_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0, force_strand = None ): + for block, idx, offset in get_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols ): + yield orient_block_by_region( block, src, region, force_strand ), idx, offset + +#split a block with multiple occurances of src into one block per src +def iter_blocks_split_by_src( block, src ): + for src_c in iter_components_by_src( block, src ): + new_block = bx.align.Alignment( score=block.score, attributes=deepcopy( block.attributes ) ) + new_block.text_size = block.text_size + for c in block.components: + if c == src_c or c.src != src: + new_block.add_component( deepcopy( c ) ) #components have reference to alignment, dont want to loose reference to original alignment block in original components + yield new_block + +#split a block into multiple blocks with all combinations of a species appearing only once per block +def iter_blocks_split_by_species( block, species = None ): + def __split_components_by_species( components_by_species, new_block ): + if components_by_species: + #more species with components to add to this block + components_by_species = deepcopy( components_by_species ) + spec_comps = components_by_species.pop( 0 ) + for c in spec_comps: + newer_block = deepcopy( new_block ) + newer_block.add_component( deepcopy( c ) ) + for value in __split_components_by_species( components_by_species, newer_block ): + yield value + else: + #no more components to add, yield this block + yield new_block + + #divide components by species + spec_dict = {} + if not species: + species = [] + for c in block.components: + spec, chrom = src_split( c.src ) + if spec not in spec_dict: + spec_dict[ spec ] = [] + species.append( spec ) + spec_dict[ spec ].append( c ) + else: + for spec in species: + spec_dict[ spec ] = [] + for c in iter_components_by_src_start( block, spec ): + spec_dict[ spec ].append( c ) + + empty_block = bx.align.Alignment( score=block.score, attributes=deepcopy( block.attributes ) ) #should we copy attributes? + empty_block.text_size = block.text_size + #call recursive function to split into each combo of spec/blocks + for value in __split_components_by_species( spec_dict.values(), empty_block ): + sort_block_components_by_block( value, block ) #restore original component order + yield value + + #generator yielding only chopped and valid blocks for a specified region -def get_chopped_blocks_for_region( index, src, region, species = None, mincols = 0, force_strand = None ): - for block, idx, offset in get_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols, force_strand ): +def get_chopped_blocks_for_region( index, src, region, species = None, mincols = 0 ): + for block, idx, offset in get_chopped_blocks_with_index_offset_for_region( index, src, region, species, mincols ): yield block -def get_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0, force_strand = None ): +def get_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0 ): for block, idx, offset in index.get_as_iterator_with_index_and_offset( src, region.start, region.end ): - block = chop_block_by_region( block, src, region, species, mincols, force_strand ) + block = chop_block_by_region( block, src, region, species, mincols ) if block is not None: yield block, idx, offset
#returns a filled region alignment for specified regions -def get_region_alignment( index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0 ): +def get_region_alignment( index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0, overwrite_with_gaps = True ): if species is not None: alignment = RegionAlignment( end - start, species ) else: alignment = RegionAlignment( end - start, primary_species ) - return fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand, species, mincols ) + return fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand, species, mincols, overwrite_with_gaps )
#reduces a block to only positions exisiting in the src provided def reduce_block_by_primary_genome( block, species, chromosome, region_start ): @@ -237,13 +386,11 @@ return ( start_offset, species_texts )
#fills a region alignment -def fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0 ): +def fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0, overwrite_with_gaps = True ): region = bx.intervals.Interval( start, end ) region.chrom = chrom region.strand = strand primary_src = "%s.%s" % ( primary_species, chrom ) - -
#Order blocks overlaping this position by score, lowest first blocks = [] @@ -255,28 +402,40 @@ break else: blocks.append( ( score, idx, offset ) ) - + + gap_chars_tuple = tuple( GAP_CHARS ) + gap_chars_str = ''.join( GAP_CHARS ) #Loop through ordered blocks and layer by increasing score - for block_dict in blocks: - block = chop_block_by_region( block_dict[1].get_at_offset( block_dict[2] ), primary_src, region, species, mincols, strand ) - if block is None: continue - start_offset, species_texts = reduce_block_by_primary_genome( block, primary_species, chrom, start ) - for spec, text in species_texts.items(): - try: - alignment.set_range( start_offset, spec, text ) - except: - #species/sequence for species does not exist - pass - + for block_dict in blocks: for block in iter_blocks_split_by_species( block_dict[1].get_at_offset( block_dict[2] ) ): #need to handle each occurance of sequence in block seperately + if component_overlaps_region( block.get_component_by_src( primary_src ), region ): + block = chop_block_by_region( block, primary_src, region, species, mincols ) #chop block + block = orient_block_by_region( block, primary_src, region ) #orient block + start_offset, species_texts = reduce_block_by_primary_genome( block, primary_species, chrom, start ) + for spec, text in species_texts.items(): + #we should trim gaps from both sides, since these are not positions in this species genome (sequence) + text = text.rstrip( gap_chars_str ) + gap_offset = 0 + while text.startswith( gap_chars_tuple ): + gap_offset += 1 + text = text[1:] + if not text: + break + if text: + if overwrite_with_gaps: + alignment.set_range( start_offset + gap_offset, spec, text ) + else: + for i, char in enumerate( text ): + if char not in GAP_CHARS: + alignment.set_position( start_offset + gap_offset + i, spec, char ) return alignment
#returns a filled spliced region alignment for specified region with start and end lists -def get_spliced_region_alignment( index, primary_species, chrom, starts, ends, strand = '+', species = None, mincols = 0 ): +def get_spliced_region_alignment( index, primary_species, chrom, starts, ends, strand = '+', species = None, mincols = 0, overwrite_with_gaps = True ): #create spliced alignment object if species is not None: alignment = SplicedAlignment( starts, ends, species ) else: alignment = SplicedAlignment( starts, ends, [primary_species] ) for exon in alignment.exons: - fill_region_alignment( exon, index, primary_species, chrom, exon.start, exon.end, strand, species, mincols) + fill_region_alignment( exon, index, primary_species, chrom, exon.start, exon.end, strand, species, mincols, overwrite_with_gaps ) return alignment
#loop through string array, only return non-commented lines @@ -319,29 +478,36 @@ starts.append( start ) ends.append( end ) return ( starts, ends, fields ) - -def get_species_in_maf( maf_filename ): - try: - species={} - - file_in = open( maf_filename, 'r' ) - maf_reader = maf.Reader( file_in ) - - for i, m in enumerate( maf_reader ): - l = m.components - for c in l: - spec, chrom = maf.src_split( c.src ) - if not spec or not chrom: - spec = chrom = c.src - species[spec] = spec - - file_in.close() - - species = species.keys() - species.sort() - return species - except: - return [] + +def iter_components_by_src( block, src ): + for c in block.components: + if c.src == src: + yield c + +def get_components_by_src( block, src ): + return [ value for value in iter_components_by_src( block, src ) ] + +def iter_components_by_src_start( block, src ): + for c in block.components: + if c.src.startswith( src ): + yield c + +def get_components_by_src_start( block, src ): + return [ value for value in iter_components_by_src_start( block, src ) ] + +def sort_block_components_by_block( block1, block2 ): + #orders the components in block1 by the index of the component in block2 + #block1 must be a subset of block2 + #occurs in-place + return block1.components.sort( cmp = lambda x, y: block2.components.index( x ) - block2.components.index( y ) ) + +def get_species_in_maf( maf_filename ): + species = [] + for block in maf.Reader( open( maf_filename ) ): + for spec in get_species_in_block( block ): + if spec not in species: + species.append( spec ) + return species
def parse_species_option( species ): if species: diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Wed Sep 09 14:24:11 2009 -0400 @@ -2001,7 +2001,6 @@ show_deleted=False, msg=msg, messagetype=messagetype ) - def _save_request_type(self, trans, **kwd): params = util.Params( kwd ) num_states = int( util.restore_text( params.get( 'num_states', 0 ) )) @@ -2031,7 +2030,6 @@ ss.flush() msg = "The new request type named '%s' with %s state(s) has been created" % (rt.name, num_states) return rt, msg - @web.expose @web.require_admin def delete_request_type( self, trans, **kwd ): @@ -2045,7 +2043,6 @@ action='manage_request_types', msg='Request type <b>%s</b> has been deleted' % rt.name, messagetype='done') ) - @web.expose @web.require_admin def undelete_request_type( self, trans, **kwd ): diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Wed Sep 09 14:24:11 2009 -0400 @@ -109,10 +109,7 @@ if not data: raise paste.httpexceptions.HTTPRequestRangeNotSatisfiable( "Invalid reference dataset id: %s." % str( dataset_id ) ) user, roles = trans.get_user_and_roles() - if trans.app.security_agent.allow_action( user, - roles, - data.permitted_actions.DATASET_ACCESS, - dataset=data.dataset ): + if trans.app.security_agent.can_access_dataset( roles, data.dataset ): if data.state == trans.model.Dataset.states.UPLOAD: return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to view it." ) if filename is None or filename.lower() == "index": @@ -147,12 +144,9 @@ return trans.show_error_message( 'Invalid parameters specified for "display at" link, please contact a Galaxy administrator' ) redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] ) user, roles = trans.get_user_and_roles() - if trans.app.security_agent.allow_action( None, None, data.permitted_actions.DATASET_ACCESS, dataset=data.dataset ): + if trans.app.security_agent.dataset_is_public( data.dataset ): return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac - if trans.app.security_agent.allow_action( user, - roles, - data.permitted_actions.DATASET_ACCESS, - dataset=data.dataset ): + if trans.app.security_agent.can_access_dataset( roles, data.dataset ): trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site ) return trans.response.send_redirect( redirect_url ) else: diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Wed Sep 09 14:24:11 2009 -0400 @@ -443,15 +443,9 @@ for hda in history.activatable_datasets: # If the current dataset is not public, we may need to perform an action on it to # make it accessible by the other user. - if not trans.app.security_agent.allow_action( send_to_user, - send_to_user.all_roles(), - trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda.dataset ): + if not trans.app.security_agent.can_access_dataset( send_to_user.all_roles(), hda.dataset ): # The user with which we are sharing the history does not have access permission on the current dataset - if trans.app.security_agent.allow_action( user, - user_roles, - trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=hda.dataset ) and not hda.dataset.library_associations: + if trans.app.security_agent.can_manage_dataset( user_roles, hda.dataset ) and not hda.dataset.library_associations: # The current user has authority to change permissions on the current dataset because # they have permission to manage permissions on the dataset and the dataset is not associated # with a library. @@ -556,15 +550,9 @@ no_change_needed[ send_to_user ][ history ] = [ hda ] else: no_change_needed[ send_to_user ][ history ].append( hda ) - elif not trans.app.security_agent.allow_action( send_to_user, - send_to_user.all_roles(), - trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda.dataset ): + elif not trans.app.security_agent.can_access_dataset( send_to_user.all_roles(), hda.dataset ): # The user with which we are sharing the history does not have access permission on the current dataset - if trans.app.security_agent.allow_action( user, - user_roles, - trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=hda.dataset ) and not hda.dataset.library_associations: + if trans.app.security_agent.can_manage_dataset( user_roles, hda.dataset ) and not hda.dataset.library_associations: # The current user has authority to change permissions on the current dataset because # they have permission to manage permissions on the dataset and the dataset is not associated # with a library. diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Wed Sep 09 14:24:11 2009 -0400 @@ -2,6 +2,7 @@ from galaxy.model.orm import * from galaxy.datatypes import sniff from galaxy import util +from galaxy.util.odict import odict from galaxy.web.controllers.forms import get_all_forms, get_form_widgets from galaxy.util.streamball import StreamBall import logging, tempfile, zipfile, tarfile, os, sys @@ -65,23 +66,24 @@ user, roles = trans.get_user_and_roles() all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \ .order_by( trans.app.model.Library.name ).all() - authorized_libraries = [] + library_actions = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD, + trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, + trans.app.security_agent.permitted_actions.LIBRARY_MANAGE ] + # The authorized_libraries dictionary looks like: { library : '1,2' }, library : '3' } + # Its keys are the libraries that should be displayed for the current user and whose values are a + # string of comma-separated folder ids, of the associated folders the should NOT be displayed. + # The folders that should not be displayed may not be a complete list, but it is ultimately passed + # to the browse_library() method and the browse_library.mako template to keep from re-checking the + # same folders when the library is rendered. + authorized_libraries = odict() for library in all_libraries: - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_ADD, - library_item=library ) or \ - trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=library ) or \ - trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=library ) or \ - trans.app.security_agent.check_folder_contents( user, roles, library.root_folder ) or \ - trans.app.security_agent.show_library_item( user, roles, library ): - authorized_libraries.append( library ) + can_access, hidden_folder_ids = trans.app.security_agent.check_folder_contents( user, roles, library.root_folder ) + if can_access: + authorized_libraries[ library ] = hidden_folder_ids + else: + can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, library_actions ) + if can_show: + authorized_libraries[ library ] = hidden_folder_ids return trans.fill_template( '/library/browse_libraries.mako', libraries=authorized_libraries, default_action=params.get( 'default_action', None ), @@ -94,6 +96,7 @@ messagetype = params.get( 'messagetype', 'done' ) id = params.get( 'id', None ) if not id: + # To handle bots msg = "You must specify a library id." return trans.response.send_redirect( web.url_for( controller='library', action='browse_libraries', @@ -102,6 +105,7 @@ messagetype='error' ) ) library = library=trans.app.model.Library.get( id ) if not library: + # To handle bots msg = "Invalid library id ( %s )." return trans.response.send_redirect( web.url_for( controller='library', action='browse_libraries', @@ -109,9 +113,11 @@ msg=util.sanitize_text( msg ), messagetype='error' ) ) created_ldda_ids = params.get( 'created_ldda_ids', '' ) + hidden_folder_ids = util.listify( util.restore_text( params.get( 'hidden_folder_ids', '' ) ) ) return trans.fill_template( '/library/browse_library.mako', library=trans.app.model.Library.get( id ), created_ldda_ids=created_ldda_ids, + hidden_folder_ids=hidden_folder_ids, default_action=params.get( 'default_action', None ), comptypes=comptypes, msg=msg, @@ -278,10 +284,7 @@ user, roles = trans.get_user_and_roles() for id in ldda_ids: ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - if not ldda or not trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset = ldda.dataset ): + if not ldda or not trans.app.security_agent.can_access_dataset( roles, ldda.dataset ): continue path = "" parent_folder = ldda.library_dataset.folder @@ -379,10 +382,7 @@ user, roles = trans.get_user_and_roles() if action == 'information': if params.get( 'edit_attributes_button', False ): - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=library_dataset ): + if trans.app.security_agent.can_modify_library_item( user, roles, library_dataset ): if params.get( 'edit_attributes_button', False ): old_name = library_dataset.name new_name = util.restore_text( params.get( 'name', '' ) ) @@ -406,10 +406,7 @@ messagetype=messagetype ) elif action == 'permissions': if params.get( 'update_roles_button', False ): - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=library_dataset ): + if trans.app.security_agent.can_manage_library_item( user, roles, library_dataset ): # The user clicked the Save button on the 'Associate With Roles' form permissions = {} for k, v in trans.app.model.Library.permitted_actions.items(): @@ -496,14 +493,8 @@ if action == 'permissions': if params.get( 'update_roles_button', False ): # The user clicked the Save button on the 'Associate With Roles' form - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=ldda ) and \ - trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=ldda.dataset ): + if trans.app.security_agent.can_manage_library_item( user, roles, ldda ) and \ + trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ): permissions = {} for k, v in trans.app.model.Dataset.permitted_actions.items(): in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ] @@ -542,10 +533,7 @@ elif action == 'edit_info': if params.get( 'change', False ): # The user clicked the Save button on the 'Change data type' form - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=ldda ): + if trans.app.security_agent.can_modify_library_item( user, roles, ldda ): if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) trans.app.model.flush() @@ -566,10 +554,7 @@ messagetype=messagetype ) elif params.get( 'save', False ): # The user clicked the Save button on the 'Edit Attributes' form - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=ldda ): + if trans.app.security_agent.can_modify_library_item( user, roles, ldda ): old_name = ldda.name new_name = util.restore_text( params.get( 'name', '' ) ) new_info = util.restore_text( params.get( 'info', '' ) ) @@ -608,10 +593,7 @@ messagetype=messagetype ) elif params.get( 'detect', False ): # The user clicked the Auto-detect button on the 'Edit Attributes' form - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=ldda ): + if trans.app.security_agent.can_modify_library_item( user, roles, ldda ): for name, spec in ldda.datatype.metadata_spec.items(): # We need to be careful about the attributes we are resetting if name not in [ 'name', 'info', 'dbkey' ]: @@ -633,10 +615,7 @@ msg=msg, messagetype=messagetype ) elif params.get( 'delete', False ): - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=folder ): + if trans.app.security_agent.can_modify_library_item( user, roles, folder ): ldda.deleted = True ldda.flush() msg = 'Dataset %s has been removed from this library' % ldda.name @@ -651,10 +630,7 @@ widgets=widgets, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=ldda ): + if trans.app.security_agent.can_modify_library_item( user, roles, ldda ): ldda.datatype.before_edit( ldda ) if "dbkey" in ldda.datatype.metadata_spec and not ldda.metadata.dbkey: # Copy dbkey into metadata, for backwards compatability @@ -692,14 +668,8 @@ messagetype='error' ) ) if action == 'permissions': if params.get( 'update_roles_button', False ): - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=ldda ) and \ - trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=ldda.dataset ): + if trans.app.security_agent.can_manage_library_item( user, roles, ldda ) and \ + trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ): permissions = {} for k, v in trans.app.model.Dataset.permitted_actions.items(): in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ] @@ -730,14 +700,8 @@ library_id=library_id, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=ldda ) and \ - trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=ldda.dataset ): + if trans.app.security_agent.can_manage_library_item( user, roles, ldda ) and \ + trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ): # Ensure that the permissions across all library items are identical, otherwise we can't update them together. check_list = [] for ldda in lddas: @@ -769,14 +733,8 @@ library_id=library_id, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_ADD, - library_item=folder ) or \ - ( replace_dataset and trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=replace_dataset ) ): + if trans.app.security_agent.can_add_library_item( user, roles, folder ) or \ + ( replace_dataset and trans.app.security_agent.can_modify_library_item( user, roles, replace_dataset ) ): if params.get( 'new_dataset_button', False ): upload_option = params.get( 'upload_option', 'upload_file' ) created_ldda_ids = trans.webapp.controllers[ 'library_dataset' ].upload_dataset( trans, @@ -799,10 +757,7 @@ # Since permissions on all LibraryDatasetDatasetAssociations must be the same at this point, we only need # to check one of them to see if the current user can manage permissions on them. check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] ) - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=check_ldda ): + if trans.app.security_agent.can_manage_library_item( user, roles, check_ldda ): if replace_dataset: default_action = '' else: @@ -924,10 +879,7 @@ # to check one of them to see if the current user can manage permissions on them. check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] ) user, roles = trans.get_user_and_roles() - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=check_ldda ): + if trans.app.security_agent.can_manage_library_item( user, roles, check_ldda ): if replace_dataset: default_action = '' else: @@ -1028,10 +980,7 @@ else: widgets = [] if params.get( 'rename_folder_button', False ): - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=folder ): + if trans.app.security_agent.can_modify_library_item( user, roles, folder ): old_name = folder.name new_name = util.restore_text( params.name ) new_description = util.restore_text( params.description ) @@ -1072,10 +1021,7 @@ elif action == 'permissions': if params.get( 'update_roles_button', False ): # The user clicked the Save button on the 'Associate With Roles' form - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, - library_item=folder ): + if trans.app.security_agent.can_manage_library_item( user, roles, folder ): permissions = {} for k, v in trans.app.model.Library.permitted_actions.items(): in_roles = [ trans.app.model.Role.get( int( x ) ) for x in util.listify( params.get( k + '_in', [] ) ) ] @@ -1198,24 +1144,40 @@ msg=util.sanitize_text( msg ), messagetype='done' ) )
-def get_authorized_libs( trans, user ): - # TODO: this is a mis-named function - the name should reflect the authorization policy - # If user is not authenticated, this method should not even be called. Also, it looks - # like all that is using this is the new request stuff, so it should be placed there. - if not user: - return [] - roles = user.all_roles() - all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \ - .order_by( trans.app.model.Library.name ).all() - authorized_libraries = [] - for library in all_libraries: - if trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_ADD, - library_item=library ) \ - or trans.app.security_agent.allow_action( user, - roles, - trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, - library_item=library ): - authorized_libraries.append( library ) - return authorized_libraries +# ---- Utility methods ------------------------------------------------------- + +def active_folders( trans, folder ): + # Much faster way of retrieving all active sub-folders within a given folder than the + # performance of the mapper. This query also eagerloads the permissions on each folder. + return trans.sa_session.query( trans.app.model.LibraryFolder ) \ + .filter_by( parent=folder, deleted=False ) \ + .options( eagerload_all( "actions" ) ) \ + .order_by( trans.app.model.LibraryFolder.table.c.name ) \ + .all() +def activatable_folders( trans, folder ): + return trans.sa_session.query( trans.app.model.LibraryFolder ) \ + .filter_by( parent=folder, purged=False ) \ + .options( eagerload_all( "actions" ) ) \ + .order_by( trans.app.model.LibraryFolder.table.c.name ) \ + .all() +def active_folders_and_lddas( trans, folder ): + folders = active_folders( trans, folder ) + # This query is much faster than the folder.active_library_datasets property + lddas = trans.sa_session.query( trans.app.model.LibraryDatasetDatasetAssociation ) \ + .filter_by( deleted=False ) \ + .join( "library_dataset" ) \ + .filter( trans.app.model.LibraryDataset.table.c.folder_id==folder.id ) \ + .order_by( trans.app.model.LibraryDatasetDatasetAssociation.table.c.name ) \ + .all() + return folders, lddas +def activatable_folders_and_lddas( trans, folder ): + folders = activatable_folders( trans, folder ) + # This query is much faster than the folder.activatable_library_datasets property + lddas = trans.sa_session.query( trans.app.model.LibraryDatasetDatasetAssociation ) \ + .join( "library_dataset" ) \ + .filter( trans.app.model.LibraryDataset.table.c.folder_id==folder.id ) \ + .join( "dataset" ) \ + .filter( trans.app.model.Dataset.table.c.deleted==False ) \ + .order_by( trans.app.model.LibraryDatasetDatasetAssociation.table.c.name ) \ + .all() + return folders, lddas diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Wed Sep 09 14:24:11 2009 -0400 @@ -4,13 +4,12 @@ from galaxy.datatypes import sniff from galaxy import util from galaxy.util.streamball import StreamBall +from galaxy.util.odict import odict import logging, tempfile, zipfile, tarfile, os, sys from galaxy.web.form_builder import * from datetime import datetime, timedelta from cgi import escape, FieldStorage from galaxy.web.controllers.forms import get_form_widgets -from galaxy.web.controllers.library import get_authorized_libs -
log = logging.getLogger( __name__ )
@@ -432,8 +431,6 @@ return self.__show_request_form(trans, **kwd) elif params.get('refresh', False) == 'true': return self.__show_request_form(trans, **kwd) - - def __show_request_form(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -460,7 +457,25 @@ helptext='(Optional)'))
# libraries selectbox - libraries = get_authorized_libs(trans, trans.user) + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \ + .order_by( trans.app.model.Library.name ).all() + user, roles = trans.get_user_and_roles() + actions_to_check = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD ] + # The libraries dictionary looks like: { library : '1,2' }, library : '3' } + # Its keys are the libraries that should be displayed for the current user and whose values are a + # string of comma-separated folder ids, of the associated folders the should NOT be displayed. + # The folders that should not be displayed may not be a complete list, but it is ultimately passed + # to the calling method to keep from re-checking the same folders when the library / folder + # select lists are rendered. + # + # TODO: RC, when you add the folders select list to your request form, take advantage of the hidden_folder_ids + # so that you do not need to check those same folders yet again when populating the select list. + # + libraries = odict() + for library in all_libraries: + can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, actions_to_check ) + if can_show: + libraries[ library ] = hidden_folder_ids libui = self.__library_ui(libraries, **kwd) widgets = widgets + libui widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd) @@ -470,12 +485,10 @@ widgets=widgets, msg=msg, messagetype=messagetype) - def __library_ui(self, libraries, request=None, **kwd): params = util.Params( kwd ) lib_id = params.get( 'library_id', 'none' ) - lib_list = SelectField('library_id', refresh_on_change=True, - refresh_on_change_values=['new']) + lib_list = SelectField( 'library_id', refresh_on_change=True, refresh_on_change_values=['new'] ) if request and lib_id == 'none': if request.library: lib_id = str(request.library.id) @@ -483,7 +496,7 @@ lib_list.add_option('Select one', 'none', selected=True) else: lib_list.add_option('Select one', 'none') - for lib in libraries: + for lib, hidden_folder_ids in libraries.items(): if str(lib.id) == lib_id: lib_list.add_option(lib.name, lib.id, selected=True) else: @@ -653,9 +666,27 @@ widgets.append(dict(label='Description', widget=TextField('desc', 40, desc), helptext='(Optional)')) - # libraries selectbox - libraries = get_authorized_libs(trans, trans.user) + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \ + .order_by( trans.app.model.Library.name ).all() + user, roles = trans.get_user_and_roles() + actions_to_check = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD ] + # The libraries dictionary looks like: + # { library : '1,2' }, library : '3' } + # Its keys are the libraries that should be displayed for the current user and whose values are a + # string of comma-separated folder ids, of the associated folders the should NOT be displayed. + # The folders that should not be displayed may not be a complete list, but it is ultimately passed + # to the calling method to keep from re-checking the same folders when the library / folder + # select lists are rendered. + # + # TODO: RC, when you add the folders select list to your request form, take advantage of the hidden_folder_ids + # so that you do not need to check those same folders yet again when populating the select list. + # + libraries = {} + for library in all_libraries: + can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, actions_to_check ) + if can_show: + libraries[ library ] = hidden_folder_ids libui = self.__library_ui(libraries, request, **kwd) widgets = widgets + libui widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd) diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Wed Sep 09 14:24:11 2009 -0400 @@ -8,7 +8,6 @@ from galaxy.web.form_builder import * from datetime import datetime, timedelta from galaxy.web.controllers.forms import get_form_widgets -from galaxy.web.controllers.library import get_authorized_libs
log = logging.getLogger( __name__ )
@@ -709,14 +708,32 @@ return select_user
def __library_ui(self, trans, user, request=None, **kwd): + """ + Return a list of libraries for which user has the permission + to perform the LIBRARY_ADD action on any of it's folders + """ params = util.Params( kwd ) lib_id = params.get( 'library_id', 'none' ) - if not user: - libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() - else: - libraries = get_authorized_libs(trans, user) - lib_list = SelectField('library_id', refresh_on_change=True, - refresh_on_change_values=['new']) + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \ + .order_by( trans.app.model.Library.name ).all() + roles = user.all_roles() + actions_to_check = [ trans.app.security_agent.permitted_actions.LIBRARY_ADD ] + # The libraries dictionary looks like: { library : '1,2' }, library : '3' } + # Its keys are the libraries that should be displayed for the current user and whose values are a + # string of comma-separated folder ids, of the associated folders the should NOT be displayed. + # The folders that should not be displayed may not be a complete list, but it is ultimately passed + # to the calling method to keep from re-checking the same folders when the library / folder + # select lists are rendered. + # + # TODO: RC, when you add the folders select list to your request form, take advantage of the hidden_folder_ids + # so that you do not need to check those same folders yet again when populating the select list. + # + libraries = {} + for library in all_libraries: + can_show, hidden_folder_ids = trans.app.security_agent.show_library_item( user, roles, library, actions_to_check ) + if can_show: + libraries[ library ] = hidden_folder_ids + lib_list = SelectField( 'library_id', refresh_on_change=True, refresh_on_change_values=['new'] ) if request and lib_id == 'none': if request.library: lib_id = str(request.library.id) @@ -724,7 +741,7 @@ lib_list.add_option('Select one', 'none', selected=True) else: lib_list.add_option('Select one', 'none') - for lib in libraries: + for lib, hidden_folder_ids in libraries.items(): if str(lib.id) == lib_id: lib_list.add_option(lib.name, lib.id, selected=True) else: diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Wed Sep 09 14:24:11 2009 -0400 @@ -153,10 +153,7 @@ return "Dataset id '%s' is invalid" %str( id ) if data: user, roles = trans.get_user_and_roles() - if trans.app.security_agent.allow_action( user, - roles, - data.permitted_actions.DATASET_ACCESS, - dataset = data.dataset ): + if trans.app.security_agent.can_access_dataset( roles, data.dataset ): mime = trans.app.datatypes_registry.get_mimetype_by_extension( data.extension.lower() ) trans.response.set_content_type(mime) if tofile: @@ -189,10 +186,7 @@ child = data.get_child_by_designation( designation ) if child: user, roles = trans.get_user_and_roles() - if trans.app.security_agent.allow_action( user, - roles, - child.permitted_actions.DATASET_ACCESS, - dataset = child ): + if trans.app.security_agent.can_access_dataset( roles, child ): return self.display( trans, id=child.id, tofile=tofile, toext=toext ) else: return "You are not privileged to access this dataset." @@ -209,10 +203,7 @@ authz_method = kwd['authz_method'] if data: user, roles = trans.get_user_and_roles() - if authz_method == 'rbac' and trans.app.security_agent.allow_action( user, - roles, - data.permitted_actions.DATASET_ACCESS, - dataset = data ): + if authz_method == 'rbac' and trans.app.security_agent.can_access_dataset( roles, data ): trans.response.set_content_type( data.get_mime() ) trans.log_event( "Formatted dataset id %s for display at %s" % ( str( id ), display_app ) ) return data.as_display_type( display_app, **kwd ) @@ -262,10 +253,7 @@ if id is not None and data.history.user is not None and data.history.user != trans.user: return trans.show_error_message( "This instance of a dataset (%s) in a history does not belong to you." % ( data.id ) ) user, roles = trans.get_user_and_roles() - if trans.app.security_agent.allow_action( user, - roles, - data.permitted_actions.DATASET_ACCESS, - dataset=data.dataset ): + if trans.app.security_agent.can_access_dataset( roles, data.dataset ): if data.state == trans.model.Dataset.states.UPLOAD: return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to edit its metadata." ) params = util.Params( kwd, safe=False ) @@ -331,10 +319,7 @@ elif params.update_roles_button: if not trans.user: return trans.show_error_message( "You must be logged in if you want to change permissions." ) - if trans.app.security_agent.allow_action( user, - roles, - data.dataset.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset = data.dataset ): + if trans.app.security_agent.can_manage_dataset( roles, data.dataset ): permissions = {} for k, v in trans.app.model.Dataset.permitted_actions.items(): in_roles = params.get( k + '_in', [] ) diff -r eba44fc830bf -r c3b40f23a0e0 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Tue Sep 08 17:33:38 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Wed Sep 09 14:24:11 2009 -0400 @@ -503,7 +503,7 @@ if user: roles = user.all_roles() else: - roles = None + roles = [] return user, roles
def user_is_admin( self ): diff -r eba44fc830bf -r c3b40f23a0e0 static/images/pileup_parser_help1.png Binary file static/images/pileup_parser_help1.png has changed diff -r eba44fc830bf -r c3b40f23a0e0 static/images/pileup_parser_help2.png Binary file static/images/pileup_parser_help2.png has changed diff -r eba44fc830bf -r c3b40f23a0e0 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/admin/library/browse_library.mako Wed Sep 09 14:24:11 2009 -0400 @@ -1,17 +1,15 @@ <%inherit file="/base.mako"/> -<%namespace file="common.mako" import="render_dataset" /> <%namespace file="/message.mako" import="render_msg" /> -<% from galaxy import util %> +<% + from time import strftime + from galaxy import util + from galaxy.web.controllers.library import active_folders_and_lddas, activatable_folders_and_lddas +%>
<%def name="stylesheets()"> <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> <link href="${h.url_for('/static/style/library.css')}" rel="stylesheet" type="text/css" /> </%def> - -<% -def name_sorted( l ): - return sorted( l, lambda a, b: cmp( a.name.lower(), b.name.lower() ) ) -%>
<script type="text/javascript"> $( document ).ready( function () { @@ -72,24 +70,77 @@ } </script>
-<%def name="render_folder( folder, folder_pad, deleted, show_deleted, created_ldda_ids, library_id )"> +<%def name="render_dataset( ldda, library_dataset, selected, library, folder, deleted, show_deleted )"> <% - root_folder = not folder.parent + ## The received data must always be a LibraryDatasetDatasetAssociation object. The object id passed to methods + ## from the drop down menu should be the ldda id to prevent id collision ( which could happen when displaying + ## children, which are always lddas ). We also need to make sure we're displaying the latest version of this + ## library_dataset, so we display the attributes from the ldda. + if ldda.user: + uploaded_by = ldda.user.email + else: + uploaded_by = 'anonymous' + if ldda == library_dataset.library_dataset_dataset_association: + current_version = True + else: + current_version = False + %> + <div class="historyItemWrapper historyItem historyItem-${ldda.state}" id="libraryItem-${ldda.id}"> + ## Header row for library items (name, state, action buttons) + <div class="historyItemTitleBar"> + <table cellspacing="0" cellpadding="0" border="0" width="100%"> + <tr> + <td width="*"> + %if selected: + <input type="checkbox" name="ldda_ids" value="${ldda.id}" checked/> + %else: + <input type="checkbox" name="ldda_ids" value="${ldda.id}"/> + %endif + <span class="libraryItemDeleted-${ldda.deleted}"> + <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a> + </span> + <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> + %if not library.deleted and not folder.deleted and not library_dataset.deleted: + <div popupmenu="dataset-${ldda.id}-popup"> + <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> + ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use + ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a> + <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> + %if current_version: + <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> + %endif + %if ldda.has_data: + <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> + %endif + <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a> + </div> + %elif not library.deleted and not folder.deleted and library_dataset.deleted: + <div popupmenu="dataset-${ldda.id}-popup"> + <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a> + </div> + %endif + </td> + <td width="300">${ldda.message}</td> + <td width="150">${uploaded_by}</td> + <td width="60">${ldda.create_time.strftime( "%Y-%m-%d" )}</td> + </tr> + </table> + </div> + </div> +</%def> + +<%def name="render_folder( folder, folder_pad, deleted, show_deleted, created_ldda_ids, library_id, root_folder=False )"> + <% if root_folder: pad = folder_pad + expander = "/static/images/silk/resultset_bottom.png" + folder_img = "/static/images/silk/folder_page.png" else: pad = folder_pad + 20 - if folder_pad == 0: - expander = "/static/images/silk/resultset_bottom.png" - folder_img = "/static/images/silk/folder_page.png" - subfolder = False - else: expander = "/static/images/silk/resultset_next.png" folder_img = "/static/images/silk/folder.png" - subfolder = True - created_ldda_id_list = util.listify( created_ldda_ids ) - if created_ldda_id_list: - created_ldda_ids = [ int( ldda_id ) for ldda_id in created_ldda_id_list ] + if created_ldda_ids: + created_ldda_ids = [ int( ldda_id ) for ldda_id in util.listify( created_ldda_ids ) ] %> %if not root_folder: <li class="folderRow libraryOrFolderRow" style="padding-left: ${pad}px;"> @@ -104,10 +155,6 @@ </div> %endif %if not folder.deleted: - <% - library_item_ids = {} - library_item_ids[ 'folder' ] = folder.id - %> <div popupmenu="folder-${folder.id}-popup"> <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a> <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a> @@ -130,30 +177,31 @@ %endif </li> %endif - %if subfolder: + %if pad > 0: <ul id="subFolder"> %else: <ul> %endif %if show_deleted: <% - parent_folders = folder.activatable_folders - parent_datasets = folder.activatable_library_datasets + sub_folders, lddas = activatable_folders_and_lddas( trans, folder ) %> %else: <% - parent_folders = folder.active_folders - parent_datasets = folder.active_library_datasets + sub_folders, lddas = active_folders_and_lddas( trans, folder ) %> %endif - %for folder in name_sorted( parent_folders ): - ${render_folder( folder, pad, deleted, show_deleted, created_ldda_ids, library_id )} - %endfor - %for library_dataset in name_sorted( parent_datasets ): + %for sub_folder in sub_folders: + ${render_folder( sub_folder, pad, deleted, show_deleted, created_ldda_ids, library_id )} + %endfor + %for ldda in lddas: <% - selected = created_ldda_ids and library_dataset.library_dataset_dataset_association.id in created_ldda_ids + library_dataset = ldda.library_dataset + selected = created_ldda_ids and ldda.id in created_ldda_ids %> - <li class="datasetRow" style="padding-left: ${pad + 18}px;">${render_dataset( library_dataset, selected, library, deleted, show_deleted )}</li> + <li class="datasetRow" style="padding-left: ${pad + 18}px;"> + ${render_dataset( ldda, library_dataset, selected, library, folder, deleted, show_deleted )} + </li> %endfor </ul> </%def> @@ -196,10 +244,6 @@ <a id="library-${library.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="library-${library.id}-popup"> %if not deleted: - <% - library_item_ids = {} - library_item_ids[ 'library' ] = library.id - %> <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this data library's information</a> ## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition ##%if library.info_association: @@ -228,7 +272,7 @@ </div> </li> <ul> - ${render_folder( library.root_folder, 0, deleted, show_deleted, created_ldda_ids, library.id )} + ${render_folder( library.root_folder, 0, deleted, show_deleted, created_ldda_ids, library.id, root_folder=True )} </ul> <br/> </ul> diff -r eba44fc830bf -r c3b40f23a0e0 templates/admin/library/common.mako --- a/templates/admin/library/common.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/admin/library/common.mako Wed Sep 09 14:24:11 2009 -0400 @@ -1,68 +1,3 @@ -<% from time import strftime %> - -<%def name="render_dataset( library_dataset, selected, library, deleted, show_deleted )"> - <% - ## The received data must always be a LibraryDataset object, but the object id passed to methods from the drop down menu - ## should be the underlying ldda id to prevent id collision ( which could happen when displaying children, which are always - ## lddas ). We also need to make sure we're displaying the latest version of this library_dataset, so we display the attributes - ## from the ldda. - ldda = library_dataset.library_dataset_dataset_association - if ldda.user: - uploaded_by = ldda.user.email - else: - uploaded_by = 'anonymous' - if ldda == ldda.library_dataset.library_dataset_dataset_association: - current_version = True - else: - current_version = False - %> - <div class="historyItemWrapper historyItem historyItem-${ldda.state}" id="libraryItem-${ldda.id}"> - ## Header row for library items (name, state, action buttons) - <div class="historyItemTitleBar"> - <table cellspacing="0" cellpadding="0" border="0" width="100%"> - <tr> - <td width="*"> - %if selected: - <input type="checkbox" name="ldda_ids" value="${ldda.id}" checked/> - %else: - <input type="checkbox" name="ldda_ids" value="${ldda.id}"/> - %endif - <span class="libraryItemDeleted-${library_dataset.deleted}"> - <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a> - </span> - <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> - %if not library.deleted and not library_dataset.folder.deleted and not library_dataset.deleted: - <% - library_item_ids = {} - library_item_ids[ 'ldda' ] = ldda.id - %> - <div popupmenu="dataset-${ldda.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> - ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use - ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> - %if current_version: - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> - %endif - %if ldda.has_data: - <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> - %endif - <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a> - </div> - %elif not library.deleted and not library_dataset.folder.deleted and library_dataset.deleted: - <div popupmenu="dataset-${ldda.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a> - </div> - %endif - </td> - <td width="300">${ldda.message}</td> - <td width="150">${uploaded_by}</td> - <td width="60">${ldda.create_time.strftime( "%Y-%m-%d" )}</td> - </tr> - </table> - </div> - </div> -</%def>
<%def name="render_template_info( library_item, library_id, widgets, editable=True )"> <% diff -r eba44fc830bf -r c3b40f23a0e0 templates/admin/library/ldda_info.mako --- a/templates/admin/library/ldda_info.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/admin/library/ldda_info.mako Wed Sep 09 14:24:11 2009 -0400 @@ -86,26 +86,14 @@ <div class="form-row"> <div>${ldda.blurb}</div> </div> - <div class="form-row"> - <div id="info${ldda.id}" class="historyItemBody"> - %if ldda.peek != "no peek": + %if ldda.peek != "no peek": + <div class="form-row"> + <div id="info${ldda.id}" class="historyItemBody"> <label>Peek:</label> <div><pre id="peek${ldda.id}" class="peek">${ldda.display_peek()}</pre></div> - %endif - ## Recurse for child datasets - %if len( ldda.visible_children ) > 0: - <div> - There are ${len( ldda.visible_children )} secondary datasets. - %for idx, child in enumerate( ldda.visible_children ): - ## TODO: do we need to clarify if the child is deleted? - %if not child.purged: - ${ render_dataset( child, selected, library, False, False ) } - %endif - %endfor - </div> - %endif + </div> </div> - </div> + %endif </div> %if widgets: ${render_template_info( ldda, library.id, widgets, editable=False )} diff -r eba44fc830bf -r c3b40f23a0e0 templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Wed Sep 09 14:24:11 2009 -0400 @@ -189,7 +189,7 @@ </div> <p />
-%if trans.app.security_agent.allow_action( user, user_roles, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=data.dataset ): +%if trans.app.security_agent.can_manage_dataset( user_roles, data.dataset ): <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> ${render_permission_form( data.dataset, data.name, h.url_for( controller='root', action='edit', id=data.id ), user_roles )} %elif trans.user: diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/browse_libraries.mako --- a/templates/library/browse_libraries.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/browse_libraries.mako Wed Sep 09 14:24:11 2009 -0400 @@ -20,9 +20,9 @@ </tr> </thead> <tbody> - %for library in libraries: + %for library, hidden_folder_ids in libraries.items(): <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> - <td><a href="${h.url_for( controller='library', action='browse_library', id=library.id )}">${library.name}</a></td> + <td><a href="${h.url_for( controller='library', action='browse_library', id=library.id, hidden_folder_ids=hidden_folder_ids )}">${library.name}</a></td> <td><i>${library.description}</i></td> </tr> %endfor diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/browse_library.mako --- a/templates/library/browse_library.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/browse_library.mako Wed Sep 09 14:24:11 2009 -0400 @@ -2,8 +2,8 @@ <%namespace file="/message.mako" import="render_msg" /> <% from galaxy import util + from galaxy.web.controllers.library import active_folders from time import strftime - user, roles = trans.get_user_and_roles() %>
@@ -14,10 +14,6 @@ </%def>
<% - -def name_sorted( l ): - return sorted( l, lambda a, b: cmp( a.name.lower(), b.name.lower() ) ) - class RowCounter( object ): def __init__( self ): self.count = 0 @@ -83,21 +79,22 @@ }); </script>
-<%def name="render_dataset( library_dataset, selected, library, pad, parent, row_conter )"> +<%def name="render_dataset( ldda, library_dataset, selected, library, folder, pad, parent, row_conter )"> <% - ## The received data must always be a LibraryDataset object, but the object id passed to methods from the drop down menu - ## should be the underlying ldda id to prevent id collision ( which could happen when displaying children, which are always - ## lddas ). We also need to make sure we're displaying the latest version of this library_dataset, so we display the attributes + ## The id passed to methods from the drop down menu should be the ldda id to prevent id collision + ## ( which could happen when displaying children, which are always lddas ). We also need to make + ## sure we're displaying the latest version of this library_dataset, so we display the attributes ## from the ldda. - ldda = library_dataset.library_dataset_dataset_association if ldda.user: uploaded_by = ldda.user.email else: uploaded_by = 'anonymous' - if ldda == ldda.library_dataset.library_dataset_dataset_association: + if ldda == library_dataset.library_dataset_dataset_association: current_version = True else: current_version = False + can_modify_library_dataset = trans.app.security_agent.can_modify_library_item( user, roles, library_dataset ) + can_manage_library_dataset = trans.app.security_agent.can_manage_library_item( user, roles, library_dataset ) %>
<tr class="datasetRow" @@ -112,19 +109,19 @@ %else: <input type="checkbox" name="ldda_ids" value="${ldda.id}"/> %endif - <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a> + <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a> <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> + %if can_modify_library_dataset: + <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> %else: - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> + <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, information=True )}">View this dataset's information</a> %endif - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> - %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> + %if can_manage_library_dataset: + <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> %endif + %if current_version and can_modify_library_dataset: + <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> %endif %if ldda.has_data: <a class="action-button" href="${h.url_for( controller='library', action='datasets', library_id=library.id, ldda_ids=str( ldda.id ), do_action='add' )}">Import this dataset into your current history</a> @@ -142,31 +139,30 @@ %> </%def>
-<%def name="render_folder( folder, folder_pad, created_ldda_ids, library_id, parent=None, row_counter=None )"> +<%def name="render_folder( folder, folder_pad, created_ldda_ids, library_id, hidden_folder_ids, parent=None, row_counter=None, root_folder=False )"> <% - def show_folder(): - ## TODO: instead of calling check_folder_contents(), which we've already done prior to getting here, - ## add a new method that will itself call check_folder_contents() and build a list of accessible folders - ## for each library - this should improve performance dor large libraries where the current user can only - ## access a small number of folders. - if trans.app.security_agent.check_folder_contents( user, roles, folder ) or \ - trans.app.security_agent.show_library_item( user, roles, folder ): - return True - return False - if not show_folder: + if str( folder.id ) in hidden_folder_ids: return "" - root_folder = not folder.parent + can_access, folder_ids = trans.app.security_agent.check_folder_contents( user, roles, folder ) + if not can_access: + can_show, folder_ids = \ + trans.app.security_agent.show_library_item( user, + roles, + folder, + [ trans.app.security_agent.permitted_actions.LIBRARY_ADD, + trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, + trans.app.security_agent.permitted_actions.LIBRARY_MANAGE ] ) + if not can_show: + return "" if root_folder: pad = folder_pad else: pad = folder_pad + 20 - if folder_pad == 0: - subfolder = False - else: - subfolder = True - created_ldda_id_list = util.listify( created_ldda_ids ) - if created_ldda_id_list: - created_ldda_ids = [ int( ldda_id ) for ldda_id in created_ldda_id_list ] + if created_ldda_ids: + created_ldda_ids = [ int( ldda_id ) for ldda_id in util.listify( created_ldda_ids ) ] + can_add = trans.app.security_agent.can_add_library_item( user, roles, folder ) + can_modify = trans.app.security_agent.can_modify_library_item( user, roles, folder ) + can_manage = trans.app.security_agent.can_manage_library_item( user, roles, folder ) my_row = None %> %if not root_folder: @@ -186,21 +182,19 @@ %endif <a id="folder_img-${folder.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="folder_img-${folder.id}-popup"> - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ): + %if can_add: <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a> <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a> %endif - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): + %if can_modify: <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">View this folder's information</a> %endif - %if forms and not folder.info_association: - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): - <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this folder</a> - %endif + %if can_add and forms and not folder.info_association: + <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this folder</a> %endif - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): + %if can_manage: <a class="action-button" href="${h.url_for( controller='library', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a> %endif </div> @@ -212,43 +206,48 @@ row_counter.increment() %> %endif - %for child_folder in name_sorted( folder.active_folders ): - ${render_folder( child_folder, pad, created_ldda_ids, library_id, my_row, row_counter )} + <% sub_folders = active_folders( trans, folder ) %> + %for sub_folder in sub_folders: + ${render_folder( sub_folder, pad, created_ldda_ids, library_id, hidden_folder_ids, parent=my_row, row_counter=row_counter )} %endfor - %for library_dataset in name_sorted( folder.active_library_datasets ): + %for library_dataset in folder.active_library_datasets: <% - selected = created_ldda_ids and library_dataset.library_dataset_dataset_association.id in created_ldda_ids + ldda = library_dataset.library_dataset_dataset_association + can_access = trans.app.security_agent.can_access_dataset( roles, ldda.dataset ) + selected = created_ldda_ids and ldda.id in created_ldda_ids %> - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): - ${render_dataset( library_dataset, selected, library, pad, my_row, row_counter )} + %if can_access: + ${render_dataset( ldda, library_dataset, selected, library, folder, pad, my_row, row_counter )} %endif %endfor </%def>
<h2>Data Library “${library.name}”</h2>
+<% +can_add = trans.app.security_agent.can_add_library_item( user, roles, library ) +can_modify = trans.app.security_agent.can_modify_library_item( user, roles, library ) +can_manage = trans.app.security_agent.can_manage_library_item( user, roles, library ) +%> + <ul class="manage-table-actions"> - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): - %if not deleted: - <li> - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a> - </li> - <li> - <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this library</a> - </li> - %endif + %if can_add and not_deleted: + <li> + <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a> + </li> + <li> + <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this library</a> + </li> %endif - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): + %if can_modify: <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">Edit this library's information</a></li> %else: <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">View this library's information</a></li> %endif - %if forms and not library.info_association: - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): - <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a> - %endif + %if can_add and forms and not library.info_association: + <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a> %endif - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): + %if can_manage: <li><a class="action-button" href="${h.url_for( controller='library', action='library', permissions=True, id=library.id )}">Edit this library's permissions</a></li> %endif </ul> @@ -258,10 +257,6 @@ %endif
<form name="import_from_library" action="${h.url_for( controller='library', action='datasets', library_id=library.id )}" method="post"> - <% - library_item_ids = {} - library_item_ids[ 'library' ] = library.id - %> <table cellspacing="0" cellpadding="0" border="0" width="100%" class="grid" id="library-grid"> <thead> <tr class="libraryTitle"> @@ -272,7 +267,7 @@ </thead> </tr> <% row_counter = RowCounter() %> - ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, None, row_counter )} + ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, hidden_folder_ids, parent=None, row_counter=row_counter, root_folder=True )} <tfoot> <tr> <td colspan="4" style="padding-left: 42px;"> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/common.mako --- a/templates/library/common.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/common.mako Wed Sep 09 14:24:11 2009 -0400 @@ -21,7 +21,7 @@ <div class="toolForm"> <div class="toolFormTitle">Other information about ${library_item_desc} ${library_item.name}</div> <div class="toolFormBody"> - %if editable and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_item ): + %if editable and trans.app.security_agent.can_modify_library_item( user, roles, library_item ): <form name="edit_info" action="${h.url_for( controller='library', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post"> <input type="hidden" name="library_item_id" value="${library_item.id}"/> <input type="hidden" name="library_item_type" value="${library_item_type}"/> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/folder_info.mako --- a/templates/library/folder_info.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/folder_info.mako Wed Sep 09 14:24:11 2009 -0400 @@ -18,7 +18,7 @@ <div class="toolForm"> <div class="toolFormTitle">Edit folder name and description</div> <div class="toolFormBody"> - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): + %if trans.app.security_agent.can_modify_library_item( user, roles, folder ): <form name="folder" action="${h.url_for( controller='library', action='folder', rename=True, id=folder.id, library_id=library_id )}" method="post" > <div class="form-row"> <label>Name:</label> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/folder_permissions.mako --- a/templates/library/folder_permissions.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/folder_permissions.mako Wed Sep 09 14:24:11 2009 -0400 @@ -15,6 +15,6 @@ ${render_msg( msg, messagetype )} %endif
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): +%if trans.app.security_agent.can_manage_library_item( user, roles, folder ): ${render_permission_form( folder, folder.name, h.url_for( controller='library', action='folder', id=folder.id, library_id=library_id, permissions=True ), trans.user.all_roles() )} %endif diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Wed Sep 09 14:24:11 2009 -0400 @@ -34,7 +34,7 @@ </select> </%def>
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): +%if trans.app.security_agent.can_modify_library_item( user, roles, ldda.library_dataset ): <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${ldda.name}</div> <div class="toolFormBody"> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/ldda_info.mako --- a/templates/library/ldda_info.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/ldda_info.mako Wed Sep 09 14:24:11 2009 -0400 @@ -40,15 +40,15 @@ Information about ${ldda.name} <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if trans.app.security_agent.can_modify_library_item( user, roles, ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> %endif - %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): + %if trans.app.security_agent.can_manage_dataset( roles, ldda.dataset ) and trans.app.security_agent.can_manage_library_item( user, roles, ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> %endif - %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if current_version and trans.app.security_agent.can_modify_library_item( user, roles, ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a> %endif %if ldda.has_data: @@ -86,28 +86,14 @@ <div class="form-row"> <div>${ldda.blurb}</div> </div> - <div class="form-row"> - <div id="info${ldda.id}" class="historyItemBody"> - %if ldda.peek != "no peek": + %if ldda.peek != "no peek": + <div class="form-row"> + <div id="info${ldda.id}" class="historyItemBody"> <label>Peek:</label> <div><pre id="peek${ldda.id}" class="peek">${ldda.display_peek()}</pre></div> - %endif - ## Recurse for child datasets - ## TODO: eliminate this - child datasets are deprecated, and where does - ## render_dataset() come from anyway - it's not imported! - %if len( ldda.visible_children ) > 0: - <div> - There are ${len( ldda.visible_children )} secondary datasets. - %for idx, child in enumerate( ldda.visible_children ): - ## TODO: do we need to clarify if the child is deleted? - %if not child.purged: - ${ render_dataset( child, selected, library ) } - %endif - %endfor - </div> - %endif + </div> </div> - </div> + %endif </div> %if widgets: ${render_template_info( ldda, library_id, widgets, editable=False )} diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_dataset_info.mako --- a/templates/library/library_dataset_info.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/library_dataset_info.mako Wed Sep 09 14:24:11 2009 -0400 @@ -21,7 +21,7 @@ ${render_msg( msg, messagetype )} %endif
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): +%if trans.app.security_agent.can_modify_library_item( user, roles, library_dataset ): <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${library_dataset.name}</div> <div class="toolFormBody"> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_dataset_permissions.mako --- a/templates/library/library_dataset_permissions.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/library_dataset_permissions.mako Wed Sep 09 14:24:11 2009 -0400 @@ -21,7 +21,7 @@ ${render_msg( msg, messagetype )} %endif
-%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_manage, library_item=library_dataset ): +%if trans.app.security_agent.can_manage_library_item( user, user_roles, library_dataset ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_info.mako --- a/templates/library/library_info.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/library_info.mako Wed Sep 09 14:24:11 2009 -0400 @@ -15,7 +15,7 @@ ${render_msg( msg, messagetype )} %endif
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): +%if trans.app.security_agent.can_modify_library_item( user, roles, library ): <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> diff -r eba44fc830bf -r c3b40f23a0e0 templates/library/library_permissions.mako --- a/templates/library/library_permissions.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/library/library_permissions.mako Wed Sep 09 14:24:11 2009 -0400 @@ -15,7 +15,7 @@ ${render_msg( msg, messagetype )} %endif
-%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): +%if trans.app.security_agent.can_manage_library_item( user, user_roles, library ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r eba44fc830bf -r c3b40f23a0e0 templates/mobile/history/detail.mako --- a/templates/mobile/history/detail.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/mobile/history/detail.mako Wed Sep 09 14:24:11 2009 -0400 @@ -37,7 +37,7 @@ <div class="secondary"> ## Body for history items, extra info and actions, data "peek" <% user, roles = trans.get_user_and_roles() %> - %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.can_access_dataset( roles, data.dataset ): <div>You do not have permission to view this dataset.</div> %elif data_state == "queued": <div>Job is waiting to run</div> diff -r eba44fc830bf -r c3b40f23a0e0 templates/mobile/manage_library.mako --- a/templates/mobile/manage_library.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/mobile/manage_library.mako Wed Sep 09 14:24:11 2009 -0400 @@ -9,7 +9,7 @@ ${render_msg( msg, messagetype )} %endif
-%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): +%if trans.app.security_agent.can_modify_library_item( user, roles, library ): <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> @@ -55,7 +55,7 @@ </div> </div> %endif -%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): +%if trans.app.security_agent.can_manage_library_item( user, roles, library ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r eba44fc830bf -r c3b40f23a0e0 templates/root/history_common.mako --- a/templates/root/history_common.mako Tue Sep 08 17:33:38 2009 -0400 +++ b/templates/root/history_common.mako Wed Sep 09 14:24:11 2009 -0400 @@ -8,7 +8,7 @@ data_state = data.state user, roles = trans.get_user_and_roles() %> - %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.can_access_dataset( roles, data.dataset ): <div class="historyItemWrapper historyItem historyItem-${data_state} historyItem-noPermission" id="historyItem-${data.id}"> %else: <div class="historyItemWrapper historyItem historyItem-${data_state}" id="historyItem-${data.id}"> @@ -42,7 +42,7 @@ ## Body for history items, extra info and actions, data "peek"
<div id="info${data.id}" class="historyItemBody"> - %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.can_access_dataset( roles, data.dataset ): <div>You do not have permission to view this dataset.</div> %elif data_state == "upload": <div>Dataset is uploading</div> diff -r eba44fc830bf -r c3b40f23a0e0 test-data/cf_maf2fasta_new.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cf_maf2fasta_new.dat Wed Sep 09 14:24:11 2009 -0400 @@ -0,0 +1,134 @@ +>hg17.chr7(+):127471195-127471526|sequence_index=0|block_index=0|species=hg17|hg17_0_0 +gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATC---ATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGG-------------------------------------------------------TATGAA---------AACATCCACTAA +>panTro1.chr6(+):129885076-129885407|sequence_index=0|block_index=0|species=panTro1|panTro1_0_0 +gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATC---ATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGG-------------------------------------------------------TATGAA---------AACATCCACTAA +>rheMac2.chr3(+):165787989-165788319|sequence_index=0|block_index=0|species=rheMac2|rheMac2_0_0 +gcttgccatcttttgatgctcttgggaatccagcagctgtcaccat-taaacaagcccaggctagaccaGTTACCCTCATC---ATCTTAGCTGATAGCCAGCCAGCCACCATAGGCAtgagtcaggccatagtgctggacccacagaattatgagctaaataagtagtgttgggttaagtcactaagttttaggcatagtgtgttatgtagcTCACAAACATATAAGACTGTGTGTTTTTTGACTGGAGGAAGAGATGCCATAAAGACCACCTTTTGAAACTTCTCAAATACTGCCATTGATGTGCTGATGGAGG-------------------------------------------------------TATGAA---------AACATCCACTAA +>rn3.chr4(+):56178191-56178473|sequence_index=0|block_index=0|species=rn3|rn3_0_0 +CTTCACTCTCATTTGCTGTT----------------CTGTCACTATGGAGACAAACACAGGCTAGCCCAGTTACTATCTTGATCACAGCAGCTGT----CAGCTAGCTGCCACTCACAGGAATAAGGCCATACCATT-GATCCACTGAACCTTGATCTAGGAATTTGGC----------------------TGGGGCCAGTTTGCGGTGTCACTCATGA--CTCTAAGATTGTGTGTTTG----CTCCAGGAAGAGACGGCAAGAGGATTACCTTTAAAAGGTTCGG-AGTCTAGCTGTAGACAGCCCAATGGG---------------------------------------------------------TATAAC---------AATACTCACTAA +>mm7.chr6(+):28984529-28984886|sequence_index=0|block_index=0|species=mm7|mm7_0_0 +CTCCACTCTCGTTTGCTGTT----------------CTGTCACCATGGAAACAAACG-AGGGTGGTCCAGTTACTATCTTG---ACTGCAGCTGG----CAGTCAGTTGCCACT--CAGGAATAAGGCTATGCCATT-GATCCACTGAACCGTGATCTGGAAACCTGGCTGTTGTTT-------CAAGCCTTGGGGCCAGTTTGCGGTGTTACTCATGA--CTCTAAGATCGTGTGCTTG----CTGCAGGAAGAGACAGCAAGGGGGTTACATTTAAAAAGCCCCC-AGTTTAGCTATAGGCAGGCCAACAGGTGTAAAAATACTCACTAGTAATGGGCTGAACTCATGGAGGTAGCATTAGTGAGACACTGTAACTGTTTTTTTAAAAATCACTAA + +>hg17.chr7(+):127471526-127471584|sequence_index=0|block_index=1|species=hg17|hg17_1_0 +AATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG +>mm7.chr6(+):28984886-28984940|sequence_index=0|block_index=1|species=mm7|mm7_1_0 +----AACGTTTCATTGATTGCTCATCATTTAAAAAAAGAAATTCCTCAGTGGAAGAGG +>rheMac2.chr3(+):165788319-165788377|sequence_index=0|block_index=1|species=rheMac2|rheMac2_1_0 +AATTTGTGGTTTATTTATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG +>panTro1.chr6(+):129885407-129885465|sequence_index=0|block_index=1|species=panTro1|panTro1_1_0 +AATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG + +>hg17.chr7(+):127471584-127471688|sequence_index=0|block_index=2|species=hg17|hg17_2_0 +GAGATATTT-GGggaaatttt-gtatagactagctt--tcacgatgttagggaattattattgtgtgataatggtcttgcagttac-acagaaattcttcctta-ttttt +>panTro1.chr6(+):129885465-129885569|sequence_index=0|block_index=2|species=panTro1|panTro1_2_0 +GAGACATTT-GGggaaatttt-gtatagactagctt--tcacgatgttagggagttattattgtgtgataatggtcttgcagttac-acagaaattcttcctta-ttttt +>rheMac2.chr3(+):165788377-165788482|sequence_index=0|block_index=2|species=rheMac2|rheMac2_2_0 +GAGATATTT-GGggaaatttg-gtatagactagctt--tcatgatgtaagggagttatttttgtgtgataatggccctacagttac-acagaaattcttccttatttttt +>canFam2.chr14(-):11090703-11090811|sequence_index=0|block_index=2|species=canFam2|canFam2_2_0 +gagatattt-gggggaatttgaatgtagtgttgctcttttgtgatgctaagaaattataattgtctgatgatagtctcgtggttatgggggaaatgcttcctta-ttttt +>bosTau2.chr4(-):50243931-50244034|sequence_index=0|block_index=2|species=bosTau2|bosTau2_2_0 +-agacattg-ggtaaaattcaaatgcagactagctc----atgatgttaaagaattactcttgtgtggtaatggtcttgtgatagagatagaaatgcttcctta-ttttt +>rn3.chr4(+):56182200-56182295|sequence_index=0|block_index=2|species=rn3|rn3_2_0 +----TATTTGGGGGAAATATG-ATGTGCA----CTT--CCATGATCTTAAAGAATTGCTACTGTTTGATAGTGATCTTATGGTTAA-ATAAAAAAAAT--CTTA-GTTGT +>dasNov1.scaffold_256527(+):298-392|sequence_index=0|block_index=2|species=dasNov1|dasNov1_2_0 +GAGACATTT-GGAGAAATTTG-----------Aatt--tcatgatgttaaggaattacttttgtatgatgatggtcttgtggctat-gtagaatttcttccgtg-tttta + +>hg17.chr7(+):127471688-127471871|sequence_index=0|block_index=3|species=hg17|hg17_3_0 +tgggaagcaccaaagta-------gggataaaatgtcatgatgtgtgcaatacactttaaaatgtttttgccaaaa----------taattaa-------------------------tgaagc--aaatatg---gaaaataataattattaaatctaggt-----gatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaatttttcattta--------------------------aaaa- +>panTro1.chr6(+):129885569-129885752|sequence_index=0|block_index=3|species=panTro1|panTro1_3_0 +tgggaaacaccaaagta-------gggataaaatgtcatgatgtgtgcaatacgctttaaaatatttttgccaaaa----------taattaa-------------------------tgaagc--aaatatg---gaaaataataattattaaatctaggt-----gatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaaattttcattta--------------------------aaaa- +>rheMac2.chr3(+):165788482-165788684|sequence_index=0|block_index=3|species=rheMac2|rheMac2_3_0 +tgggaagcacaaaagta-------gggataaaatgtcatgatgtgtacaatatgctttaaaatatttttgccaaaa----------taattaa-------------------------tgaagc--aaatatg---gaaaataataactgttaaatctaggt-----gttgggtatattgcagttcattatgttattgcacacttttctgtgtgtttaaaattttcatttaaaaatatgttttaaaaatg-------aaaa- +>rn3.chr4(+):56182295-56182489|sequence_index=0|block_index=3|species=rn3|rn3_3_0 +TAGAAAATACTCAAATATTTAGGGGCGTGACAATGTCACAGTGTCTGCAATTTGCTTTAAAGATTTTT-----AAA----------TATTTAAAAAAGTTTTAATAATTTTGAAAAACTGAAGCTACACTATG---GGAAGTGGTAATTGTTACATATGGGT-----AATAAGTAT-----AATTCGTTATATTAT-------TTTTC------TTAGAATTTTTCATTTG--------------------------AAAA- +>bosTau2.chr4(-):50243792-50243930|sequence_index=0|block_index=3|species=bosTau2|bosTau2_3_0 +agataaacacttaagtattta---aggatgaaacgccctgatgtttgtaatttgctttagaatattttagccaaaa----------gaattaa-------------------------tgatgc--aaatatg--caaaaagagta--cgttaaacctaa-----------------------------------------------------atttgCGATTttcattta--------------------------aaaa- +>canFam2.chr14(-):11090345-11090505|sequence_index=0|block_index=3|species=canFam2|canFam2_3_0 +agacacaaactgaagtattta---aggatgaaatgtcatgatgtttgcaattggctttaaaatattttagccaaaa-----------agtaaa-------------------------tgaagc--AAATATG--GGAAGACAATAATCATTAAATCTAGGT-----GATGCATAC---------------------------TTTTCCATATGTTTGAAATTTTCATTTA--------------------------AAAA- +>dasNov1.scaffold_256527(+):393-625|sequence_index=0|block_index=3|species=dasNov1|dasNov1_3_0 +agacgcatgctgaagcatgta---aggataaaatgtcgtggtgtttgtaatttattctaaaacattttagccaaaaacaaataaataaataaa-------------------------tgaagc--aaatatgggggaaatgtttaattgttaaatctagatttaacacggtatataccgtgcttcattatactagtctctacttttccatgtgtttgaaattttCATTAAAATGTTTGTTTGTTGTCTGTTTTAATGAAAT + +>hg17.chr7(+):127471871-127471910|sequence_index=0|block_index=4|species=hg17|hg17_4_0 +actttgagctagacaccaggctatgagcta-ggagcatag +>rheMac2.chr3(+):165788684-165788723|sequence_index=0|block_index=4|species=rheMac2|rheMac2_4_0 +actttgagctagataccaggttatgagcta-ggagcatag +>panTro1.chr6(+):129885752-129885791|sequence_index=0|block_index=4|species=panTro1|panTro1_4_0 +actttgagctagacaccaggctatgagcta-ggagcatag +>bosTau2.chr4(-):50243734-50243773|sequence_index=0|block_index=4|species=bosTau2|bosTau2_4_0 +tcttcgtgcaacgcacggggctatcaatgt-gggatacag +>canFam2.chr14(-):11090081-11090120|sequence_index=0|block_index=4|species=canFam2|canFam2_4_0 +ACATCAtgctagatcctggactatgagctg-ggtatatag +>dasNov1.scaffold_256527(+):625-665|sequence_index=0|block_index=4|species=dasNov1|dasNov1_4_0 +CCTTTGTGCTAGCCACTGGGATGAAAGCTAGGGAACACAG + +>hg17.chr7(+):127471910-127472074|sequence_index=0|block_index=5|species=hg17|hg17_5_0 +caatgaccaa----------------------------------------------------------------------------------------------atagactcctaccaa-ctc-aaagaatgcacattctCTG-GGAAACATGTTTCCATTAGGAAGCCTCGAATGCAATGTGACTGTGGTCTCCAGGACCTG-TGTGATCCTGGCTTTTCCTGTTCCCTCCG---CATCATCACTGCAGGTGTGTTTTCCCAAG +>panTro1.chr6(+):129885791-129885955|sequence_index=0|block_index=5|species=panTro1|panTro1_5_0 +caatgaccaa----------------------------------------------------------------------------------------------atagactcctaccaa-ctc-aaagaatgcacattctCTG-GGAAACATGTTTCCATTAGGAAGCCTCGAATGCAATGTGACTGTGGTCTCCAGGACATG-TGTGATCCTGGCTTTTCCTGTTCCCTCTG---CATCATCACTGCAGGTGTATTTTCCCAAG +>rheMac2.chr3(+):165788723-165788885|sequence_index=0|block_index=5|species=rheMac2|rheMac2_5_0 +caatgaccaa----------------------------------------------------------------------------------------------atagacccctaccga-ctc-aaagaatgtacattctTTG-GGAAACATGTTTCCATCAGAAAATCTCAAATGCAATGTGACTGGGGTCTCCAGGACCTG-TGTGAGCCTGGCTTTTCCTGTTCCCTCCA---CATCATCACTGCAGGTGTATTTTCCC--G +>mm7.chr6(+):28990714-28990875|sequence_index=0|block_index=5|species=mm7|mm7_5_0 +caaaaaccaa------------------------------------------------------------------------------------------------aaaaACCTATAGC-CTC-ACAGGGTGGGTTGTCTTTG-AGGAACATGCATCCGCTAGAAAGTCCCAAGTACACTATGACAGTTG--CCCAGGCCCCGCCTTAAACCTGGTTTTCCTGGTTTCTTTCA---CATCATTACCACGAATATATTTCCTCAAG +>rn3.chr4(+):56183448-56183705|sequence_index=0|block_index=5|species=rn3|rn3_5_0 +--ATGACCAATATACACTGTTTACATGTATAGCATTGTGAATGGAGACATAAAAAGATAATCTAGCTTTGTGCTAGGTAGGTGCTGAGCTCTTAACAGTGCTGGGCAGAAACCTATAAC-CTC-ACAGGGTGGGTTGTCTTTG-AGGAGCGTGCTAACCCTAGGAAGTCTCAAATACAATGTGATGGTTGCCCCCAGGCACCACCTTGAACCTGGTCTTCCTGGTTTCTTTCA---CACCATTACCACAAATACATTTTCTCAGG +>bosTau2.chr4(-):50243566-50243734|sequence_index=0|block_index=5|species=bosTau2|bosTau2_5_0 +atgtgaacaa---------------------------------------------------------------------------------------------aacggacccgtgtgggactcggcggagcacacagattttgcgggagCACGTTCCCGTTAGGAAGTCTCTGATGCAATACGACCGGTGCCTTCAGGACCTG-TG--AGGCTGACTTTCCTTA-CCCCTCCACACCATCATCAAGGCAGGTGTGATTTTCCAGG +>canFam2.chr14(-):11089913-11090081|sequence_index=0|block_index=5|species=canFam2|canFam2_5_0 +cagtgaacaa---------------------------------------------------------------------------------------------aacagagccctgcagt-cttgatggagcacacaacctttg-gggaaCATGTTTCCATAAGAAAGTCTCCAATGTGATCTGA-TGGTGCCGCCAGGACCTA-TGTCAGCCTACCGTTCCATGTCCCCTCCACACCATCATCACTGCAGGTGTGTTTTCCCACA +>dasNov1.scaffold_256527(+):665-786|sequence_index=0|block_index=5|species=dasNov1|dasNov1_5_0 +CAGTGAGCAA-----------------------------------------------------------------------------------------------CAGCCTGGCTCCGT-CC--GGGGGCCGCTCAGCAGCTC-GGGAGCGTGGAGACG---GGAAGTCTGTCACGCGATGCG-----------CTGGGCCCG------------CTGTTCCCGCCCCCCTCC---CCCC----------------TTTCCCAAG + +>hg17.chr7(+):127472074-127472258|sequence_index=0|block_index=6|species=hg17|hg17_6_0 +TTTTAAA------CATTTACCTTCCCAGTGGCCTTGCGTCTAGAGGAATCCCTGTATAGTGGT-ACATGAATATAACACATAACAAA-AATCATCTCTATGGTGTGTGTTGTTCCTGGGGTTCAattcagcaaatttt-ccc-tgggcacccatgtgttcttggcactggaaaagtaccgggactgaaacagtt +>panTro1.chr6(+):129885955-129886139|sequence_index=0|block_index=6|species=panTro1|panTro1_6_0 +TTTTAAA------CATTTACCTTCCCAGTGGCCTTGCGTCTAGAGGAATCCCTGTATAGTGGT-ACATGAATATAACACATAACAAA-AATCATCTCTATGGTGTGTGTTGTTCCTGGGGTTCAattcagcaaatttt-tcc-tgggcacccatgtgttcttggcactggaaaagtaccgggactgaaacagtt +>rheMac2.chr3(+):165788885-165789069|sequence_index=0|block_index=6|species=rheMac2|rheMac2_6_0 +TTTTAAA------CATTTACTCTCCCAGTAGCCTTGCATCTCGAGGAATCCCTGTATAGTGGT-ACATGAATATAACACATAACAAA-AATCATCTGTACGGTGTGTGTTGTTCCTGGGGTTCAattcagcaaatttt-tcc-tgggcacccctgtgttcttggcactggaaaagtaccaggacttaaatagta +>mm7.chr6(+):28990875-28991025|sequence_index=0|block_index=6|species=mm7|mm7_6_0 +TTTAAAGAAAGTACCCCCTCCTTTCCAGT-GCCTCAAATCTAGAAGAATATTCATAGTGAAGT-GC------------------------ACAGCCGGGTGGTGCATGGTA-ATCTGGAAGTCACCTCTGCAAATCTT-TCC----------------TGTTGGTGCTGTGAAGGCACCAGGACTTCAAGAGTA +>rn3.chr4(+):56183705-56183879|sequence_index=0|block_index=6|species=rn3|rn3_6_0 +TTTAAAAGAAGT-CCCACTCCTTTCCAGT-GCCCTAGATCTAGAAGCACATTCATAATGATGT-ACAC-----TAACCC----------GACAGCTGTGTGGTATATGGTA-TCCCGGAAGTCACCTCAGCAAACCTT-TCCCGGGGAACCTACATGGTGTTGGTGCTGTGAAGGTACCAGGTTGTCAAGGGTA +>canFam2.chr14(-):11089743-11089913|sequence_index=0|block_index=6|species=canFam2|canFam2_6_0 +TTTTAAA------TATCTGC-TTCCCGGTGGCCTTGAGTCTAGAGGAGTCCCCCCACTATGGTGGCACTAATACTGAAGGTCAGAAATAATCAGTTCTGTGGTGCATGTTGCCCCTGAGGTTCTGTTCGGGAAACTTC-TTC-TGAGCAC----ATGCACCTGGCACTGCAAACGTACCAGGA----------- +>dasNov1.scaffold_256527(+):786-964|sequence_index=0|block_index=6|species=dasNov1|dasNov1_6_0 +TTTTAAA------AATTTACCTTCCCAGTGGCGGTGAATCCGGAGGAATACGGAAACTGGGGC-GCACTACCATGACACGTGTCAAA-AATCAGTTCCGTGGTCCGTGGAGGGCCTGGGGTTC------GAAAATCTTGTCC-CGAGCACCCCCGTGCGCCTGGCACCGCGACAGTGACAGGACTGAAGCGTG- + +>hg17.chr7(+):127472258-127472280|sequence_index=0|block_index=7|species=hg17|hg17_7_0 +gatggccca-atccctgtcctct- +>panTro1.chr6(+):129886139-129886161|sequence_index=0|block_index=7|species=panTro1|panTro1_7_0 +gatggccca-atccctgtcctct- +>rheMac2.chr3(+):165789069-165789091|sequence_index=0|block_index=7|species=rheMac2|rheMac2_7_0 +gatggccca-atccctgtcctct- +>mm7.chr6(+):28991025-28991048|sequence_index=0|block_index=7|species=mm7|mm7_7_0 +AATGGCAGAGGGCTCTGTTCTCT- +>rn3.chr4(+):56183879-56183902|sequence_index=0|block_index=7|species=rn3|rn3_7_0 +AATGGCAGAGGCCCCTGTTCTCT- +>canFam2.chr14(-):11089526-11089548|sequence_index=0|block_index=7|species=canFam2|canFam2_7_0 +GGAGACTTG-ATGCCTGCCTTCC- +>dasNov1.scaffold_256527(+):964-987|sequence_index=0|block_index=7|species=dasNov1|dasNov1_7_0 +GACGGCCAG-ACCTCTGCCCTCGG + +>hg17.chr7(+):127472280-127472681|sequence_index=0|block_index=8|species=hg17|hg17_8_0 +taaaacctaagggaggagaTGGAAAG-GGGCACCCAACCCAGACTGAGAGACAGGAATTAGCTGCAAGGGGAACTAGGAAAAGCTTCTTTA---AGGATG--GAGAGGCCCTA-GTGGAATGGGGAGATTCTTCCGGGAGAAGCGATGGATGCACAGTTGGGCATCCCCACAGACGGACTGGAAAGAAAAAAGGCCTGGAGGAATCA------ATGTGC-AATGTATGTGTGTTCCCTGGTTcaagggctgg-gaactttctcta--aagggccaggtagaaaacattttaggctttctaagccaagg---caaaattgaggat-attacatgggtacttatacaacaagaataaacaatt---tacacaa-ttttttgttgacagaattcaaaa---ctttat----agacac---agaaatgcaaatttcctgt +>panTro1.chr6(+):129886161-129886562|sequence_index=0|block_index=8|species=panTro1|panTro1_8_0 +taaaacctaagggaggagaTGGAAAG-GGGCACCCAACCCAGACTGAGAGACAGGAATTAGCTGCAAGGGGAACTAGGAAAAGCTTCTTTA---AGGATG--GAGAGACCCTA-GTGGAATGGGGAGATTCTTCCGGGAGAAGCGATGGATGCGCAGTTGGGCATCCCCACAGACGGACTGGAAAGAAAAAAGGCCTGGAGGAATCA------ATGTGC-AATGTATGTGTGTTCCCTGGTTcaagggctgg-gaactttctcta--aagggccaggtagaaaacattttaggctttctaagccaagg---caaaattgaggat-attacatgggtacttatacaacaagaataaacaatt---tacacaa-ttttttgttgacagaattcaaaa---ctttat----agacac---agaaatgtaaatttcctgt +>rheMac2.chr3(+):165789091-165789492|sequence_index=0|block_index=8|species=rheMac2|rheMac2_8_0 +taaaacctaatggaggagatggaATG-GGTCACCCAACCCGGACTGAGAGACAGGAATTAGCTGCAAGGGTAACCAGGACAAGCTTCTCTA---ATGATG--GAGAGACCCTA-GTGGAATGGGGAGATTCTTCTGGGAGAAGCGATGGATTCGTAGTTGGGCATCCCCACAGAGGGACTGGAAAGAAAAAAGACCTGGAGGAACCA------ATGTGC-AATGTATGTGTGTTTCCTGGTTcaagggctggcaaactttctcta--aagggccagatagaaaacattttaggctttgtaagccaagg---caaaatcgaggag-attacatgggtacttatacaacaagaataaacaatt---tccacaa--tttttattcacagaattcaaaa---ctttat----agacac---agaaatgtaaatttcctgt +>rn3.chr4(+):56183902-56184219|sequence_index=0|block_index=8|species=rn3|rn3_8_0 +------------------------------------GTCCATAGTCAAAG------------------------------AAGCCTCTCAG---ATGGAG--AGCAGGGCCTATGCAAAAGAGGGGGCTTCTGTAGGCAGAAGGGATGGACTAGCCTCCGGACATAGCCATAGAGAGGCTGGCAGGACTGAGACCCAGGAGAAGCCAGCGCAGGTGTGCGGGCGTGTGTATATTTCATAGTTTGCAGGTTGG----------------------------CAAACAATTCCTGCTTTGCAGGCCAAGA---GGAAACTGAAGGTGACCCCGTGAGTGCTTAC---ACAAGAGAAAACAAG-------ACAA-TTTTTGGTTGACCAAATTCAGAA---CTTTATTTGAGGATGC---TAAAGTTTAAATTTCTTTT +>canFam2.chr14(-):11089143-11089523|sequence_index=0|block_index=8|species=canFam2|canFam2_8_0 +TACAGCCTGTGGGCAGAGGTGGGAAGAGGTCACGCAAGCCAGTTGGAATGAGGGGAGTTGGCTGGAAAGGTGACCAGGACAAGCTACTTCAACCAGGAAG--AAGAGACCCCG-GTG----------------CTTGGAGAAGGCCTGATTGAGCAGTCCTGCATGCCCGCCCAC-GACTGGCAGGAATAAAGACCCAGAAGAGCTA------ACGTGC-AATGTA------TTTTCTAGTTCCAgggttggcaaactttctctct-aagggtgggatgataaacattttaggcttttcagaccaaga---ggcgacatcagag-ggtatgtaggt---------acaagagggaaaagttgcccccggaa-ttttttg--gataaaattcaaaa---ctttacttagggatgc---caaaatgtaaacttcatat +>dasNov1.scaffold_256527(+):987-1401|sequence_index=0|block_index=8|species=dasNov1|dasNov1_8_0 +CTAAATCTCGCGGAGAAGGTGGAACA-GGTTACCCAAACCCGACCGAG-GAGGCGAGTTG---GAAACGGCGACTGGGACAAGCTCCCTCA---GAGACGGAGAGAGACCCCA-GTGGAAGGGGGGAGAGGCTCTTAGGGAAACGATGGGGGGACCCGCCCGCACCCGCACAGAGGCGCTGGCAGGCACAGCGGCCCCGAGGAGCCC------AGGAGC-AGGGC-TGTGT-TCCCCTGCATcaggggttggcaaactttttctgcaaagggccagatagtaaatattttaggctttgcaaaccaagaagtagaaagggaggcc-attatgtacgtatttatatagcaagagagaacattt---cccacaatttttttattgacagaatttaaaacttctttattgatgaacaccaaagaaacttgaatttcatat + +>hg17.chr7(+):127472681-127472715|sequence_index=0|block_index=9|species=hg17|hg17_9_0 +aattttcccat---gagaactattcttcttttgtttt +>rheMac2.chr3(+):165789492-165789526|sequence_index=0|block_index=9|species=rheMac2|rheMac2_9_0 +aattttcacat---aagaactattcttcttttgtttt +>panTro1.chr6(+):129886562-129886596|sequence_index=0|block_index=9|species=panTro1|panTro1_9_0 +aattttcccgt---gagaactattcttcttttgtttt +>canFam2.chr14(-):11089108-11089143|sequence_index=0|block_index=9|species=canFam2|canFam2_9_0 +aatggtcatgt--ccataactattcttcttttatttt +>dasNov1.scaffold_256527(+):1401-1433|sequence_index=0|block_index=9|species=dasNov1|dasNov1_9_0 +aattttcacatatcacgaagtatttttttttt----- + diff -r eba44fc830bf -r c3b40f23a0e0 test-data/closest_features_either.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closest_features_either.interval Wed Sep 09 14:24:11 2009 -0400 @@ -0,0 +1,424 @@ +chr22 30128507 30133507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30136507 30141507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30132507 30137507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30140507 30145507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30136507 30141507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30128507 30133507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30140507 30145507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30132507 30137507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30144507 30149507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30136507 30141507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30148507 30153507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30140507 30145507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30152507 30157507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30144507 30149507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30156507 30161507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30148507 30153507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30160507 30165507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30152507 30157507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30164507 30169507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30156507 30161507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30168507 30173507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30160507 30165507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30172507 30177507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30164507 30169507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30176507 30181507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30168507 30173507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30180507 30185507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30172507 30177507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30184507 30189507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30176507 30181507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30188507 30193507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30180507 30185507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30192507 30197507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30184507 30189507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30196507 30201507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30188507 30193507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30200507 30205507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30192507 30197507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30204507 30209507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30196507 30201507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30208507 30213507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30200507 30205507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30212507 30217507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30204507 30209507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30216507 30221507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30208507 30213507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30220507 30225507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30212507 30217507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30224507 30229507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30216507 30221507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30228507 30233507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30220507 30225507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30232507 30237507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30224507 30229507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30236507 30241507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30228507 30233507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30240507 30245507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30232507 30237507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30244507 30249507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30236507 30241507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30248507 30253507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30240507 30245507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30252507 30257507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30244507 30249507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30256507 30261507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30248507 30253507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30260507 30265507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30252507 30257507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30264507 30269507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30256507 30261507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30268507 30273507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30260507 30265507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30272507 30277507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30264507 30269507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30276507 30281507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30268507 30273507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30280507 30285507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30272507 30277507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30284507 30289507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30276507 30281507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30288507 30293507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30280507 30285507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30292507 30297507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30284507 30289507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30296507 30301507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30288507 30293507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30300507 30305507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30292507 30297507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30304507 30309507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30296507 30301507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30308507 30313507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30300507 30305507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30312507 30317507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30304507 30309507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30316507 30321507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30308507 30313507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30320507 30325507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30312507 30317507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30324507 30329507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30316507 30321507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30328507 30333507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30320507 30325507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30332507 30337507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30324507 30329507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30336507 30341507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30328507 30333507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30340507 30345507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30332507 30337507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30344507 30349507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30336507 30341507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30348507 30353507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30340507 30345507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30352507 30357507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30344507 30349507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30356507 30361507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30348507 30353507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30360507 30365507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30352507 30357507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30364507 30369507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30356507 30361507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30368507 30373507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30360507 30365507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30372507 30377507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30364507 30369507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30376507 30381507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30368507 30373507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30380507 30385507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30372507 30377507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30384507 30389507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30376507 30381507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30388507 30393507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30380507 30385507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30392507 30397507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30384507 30389507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30396507 30401507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30388507 30393507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30400507 30405507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30392507 30397507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30404507 30409507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30396507 30401507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30408507 30413507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30400507 30405507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30412507 30417507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30404507 30409507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30416507 30421507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30408507 30413507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30420507 30425507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30412507 30417507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30424507 30429507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30416507 30421507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30428507 30433507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30420507 30425507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30432507 30437507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30424507 30429507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30436507 30441507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30428507 30433507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30440507 30445507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30432507 30437507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30444507 30449507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30436507 30441507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30448507 30453507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30440507 30445507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30452507 30457507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30444507 30449507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30456507 30461507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30448507 30453507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30460507 30465507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30452507 30457507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30464507 30469507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30456507 30461507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30468507 30473507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30460507 30465507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30472507 30477507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30464507 30469507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30476507 30481507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30468507 30473507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30480507 30485507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30472507 30477507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30484507 30489507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30476507 30481507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30488507 30493507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30480507 30485507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30492507 30497507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30484507 30489507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30496507 30501507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30488507 30493507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30500507 30505507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30492507 30497507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30504507 30509507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30496507 30501507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30508507 30513507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30500507 30505507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30512507 30517507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30504507 30509507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30516507 30521507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30508507 30513507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30520507 30525507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30512507 30517507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30524507 30529507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30516507 30521507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30528507 30533507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30520507 30525507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30532507 30537507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30524507 30529507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30536507 30541507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30528507 30533507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30540507 30545507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30532507 30537507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30544507 30549507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30536507 30541507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30548507 30553507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30540507 30545507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30552507 30557507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30544507 30549507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30556507 30561507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30548507 30553507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30560507 30565507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30552507 30557507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30564507 30569507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30556507 30561507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30568507 30573507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30560507 30565507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30572507 30577507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30564507 30569507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30576507 30581507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30568507 30573507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30580507 30585507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30572507 30577507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30584507 30589507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30576507 30581507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30588507 30593507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30580507 30585507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30592507 30597507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30584507 30589507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30596507 30601507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30588507 30593507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30600507 30605507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30592507 30597507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30604507 30609507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30596507 30601507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30608507 30613507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30600507 30605507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30612507 30617507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30604507 30609507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30616507 30621507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30608507 30613507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30620507 30625507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30612507 30617507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30624507 30629507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30616507 30621507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30628507 30633507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30620507 30625507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30632507 30637507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30624507 30629507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30636507 30641507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30628507 30633507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30640507 30645507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30632507 30637507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30644507 30649507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30636507 30641507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30648507 30653507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30640507 30645507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30652507 30657507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30644507 30649507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30656507 30661507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30648507 30653507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30660507 30665507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30652507 30657507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30664507 30669507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30656507 30661507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30668507 30673507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30660507 30665507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30672507 30677507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30664507 30669507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30676507 30681507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30668507 30673507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30680507 30685507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30672507 30677507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30684507 30689507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30676507 30681507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30688507 30693507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30680507 30685507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30692507 30697507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30684507 30689507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30696507 30701507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30688507 30693507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30700507 30705507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30692507 30697507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30704507 30709507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30696507 30701507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30708507 30713507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30700507 30705507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30712507 30717507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30704507 30709507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30716507 30721507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30708507 30713507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30720507 30725507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30712507 30717507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30724507 30729507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30716507 30721507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30728507 30733507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30720507 30725507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30732507 30737507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30724507 30729507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30736507 30741507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30728507 30733507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30740507 30745507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30732507 30737507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30744507 30749507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30736507 30741507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30748507 30753507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30740507 30745507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30752507 30757507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30744507 30749507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30756507 30761507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30748507 30753507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30760507 30765507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30752507 30757507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30764507 30769507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30756507 30761507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30768507 30773507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30760507 30765507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30772507 30777507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30764507 30769507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30776507 30781507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30768507 30773507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30780507 30785507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30772507 30777507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30784507 30789507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30776507 30781507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30788507 30793507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30780507 30785507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30792507 30797507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30784507 30789507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30796507 30801507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30788507 30793507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30800507 30805507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30792507 30797507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30804507 30809507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30796507 30801507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30808507 30813507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30800507 30805507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30812507 30817507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30804507 30809507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30816507 30821507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30808507 30813507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30820507 30825507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30812507 30817507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30824507 30829507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30816507 30821507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30828507 30833507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30820507 30825507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30832507 30837507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30824507 30829507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30836507 30841507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30828507 30833507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30840507 30845507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30832507 30837507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30844507 30849507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30836507 30841507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30848507 30853507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30840507 30845507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30852507 30857507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30844507 30849507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30856507 30861507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30848507 30853507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30860507 30865507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30852507 30857507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30864507 30869507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30856507 30861507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30868507 30873507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30860507 30865507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30872507 30877507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30864507 30869507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30876507 30881507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30868507 30873507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30880507 30885507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30872507 30877507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30884507 30889507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30876507 30881507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30888507 30893507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30880507 30885507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30892507 30897507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30884507 30889507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30896507 30901507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30888507 30893507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30900507 30905507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30892507 30897507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30904507 30909507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30896507 30901507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30908507 30913507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30900507 30905507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30912507 30917507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30904507 30909507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30916507 30921507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30908507 30913507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30920507 30925507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30912507 30917507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30924507 30929507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30916507 30921507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30928507 30933507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30920507 30925507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30932507 30937507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30924507 30929507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30936507 30941507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30928507 30933507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30940507 30945507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30932507 30937507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30944507 30949507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30936507 30941507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30948507 30953507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30940507 30945507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30952507 30957507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30944507 30949507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30956507 30961507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30948507 30953507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30960507 30965507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30952507 30957507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30964507 30969507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30956507 30961507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30968507 30973507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30960507 30965507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30972507 30977507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30964507 30969507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30976507 30981507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30968507 30973507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30980507 30985507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30972507 30977507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30984507 30989507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30976507 30981507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30988507 30993507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30980507 30985507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30992507 30997507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30984507 30989507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 30996507 31001507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30988507 30993507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31000507 31005507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30992507 30997507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31004507 31009507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 30996507 31001507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31008507 31013507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31000507 31005507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31012507 31017507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31004507 31009507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31016507 31021507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31008507 31013507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31020507 31025507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31012507 31017507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31024507 31029507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31016507 31021507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31028507 31033507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31020507 31025507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31032507 31037507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31024507 31029507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31036507 31041507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31028507 31033507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31040507 31045507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31032507 31037507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31044507 31049507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31036507 31041507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31048507 31053507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31040507 31045507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31052507 31057507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31044507 31049507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31056507 31061507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31048507 31053507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31060507 31065507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31052507 31057507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31064507 31069507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31056507 31061507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31068507 31073507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31060507 31065507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31072507 31077507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31064507 31069507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31076507 31081507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31068507 31073507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31080507 31085507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31072507 31077507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31084507 31089507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31076507 31081507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31088507 31093507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31080507 31085507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31092507 31097507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31084507 31089507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31096507 31101507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31088507 31093507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31100507 31105507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31092507 31097507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31104507 31109507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31096507 31101507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31108507 31113507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31100507 31105507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31112507 31117507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31104507 31109507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31116507 31121507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31108507 31113507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31120507 31125507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31112507 31117507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31124507 31129507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31116507 31121507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31128507 31133507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31120507 31125507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31132507 31137507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31124507 31129507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31136507 31141507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31128507 31133507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31140507 31145507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31132507 31137507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31144507 31149507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31136507 31141507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31148507 31153507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31140507 31145507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31152507 31157507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31144507 31149507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31156507 31161507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31148507 31153507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31160507 31165507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31152507 31157507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31164507 31169507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31156507 31161507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31168507 31173507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31160507 31165507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31172507 31177507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31164507 31169507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31176507 31181507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31168507 31173507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31180507 31185507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31172507 31177507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31184507 31189507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31176507 31181507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31188507 31193507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31180507 31185507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31192507 31197507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31184507 31189507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31196507 31201507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31188507 31193507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31200507 31205507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31192507 31197507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31204507 31209507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31196507 31201507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31208507 31213507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31200507 31205507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31212507 31217507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31204507 31209507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31216507 31221507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31208507 31213507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31220507 31225507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31212507 31217507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + +chr22 31224507 31229507 uc003bnx.1_cds_2_0_chr22_29227_f 0 + chr22 31216507 31221507 uc003bnx.1_cds_2_0_chr22_29227_f 0 +