Il 25.02.2015 15:07 Roberto Alonso CIPF ha scritto:

Hello again :),

I have found the problem, the code that merge the files is this:

galaxy/datatypes/tabular.py:484:            cmd = 'egrep -v "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file )

This concatenates the file name into the sam file. Just adding "h" it is enough, so it will be like this:

galaxy/datatypes/tabular.py:484:            cmd = 'egrep -hv "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file )

Thanks all for your help, best regards

On 25 February 2015 at 12:31, Roberto Alonso CIPF <ralonso@cipf.es> wrote:

Ok, I think I understand the line:

beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null

it refers to the original command, so everything is fine with this line. The other problem still remains

Regards, sorry for the confusion

On 25 February 2015 at 11:40, Roberto Alonso CIPF <ralonso@cipf.es> wrote:

Hello again,

this is something that I consider important, when I see the log I see this output:

galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null

I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this?

Thanks a lot,

Regards

On 25 February 2015 at 11:13, Roberto Alonso CIPF <ralonso@cipf.es> wrote:

Hello,

I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:

 https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam

Best regards

On 24 February 2015 at 17:49, Peter Cock <p.j.a.cock@googlemail.com> wrote:

On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <ralonso@cipf.es> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
>
>   map with bwa
>    > split_mode="number_of_parts">
>
>   
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null
>   
>     
>   
>   
>       
>   
>
>   
>   bwa
>   
>
>

One minor improvement would be to escape the ">" as ">" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter

--

Roberto Alonso

Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)

C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: ralonso@cipf.es

--

Roberto Alonso

Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)

C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: ralonso@cipf.es

--

Roberto Alonso

Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)

C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: ralonso@cipf.es

--

Roberto Alonso

Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)

C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: ralonso@cipf.es