On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <ralonso@cipf.es> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
> ...
> return [cmd]
> get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.
Good.
> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
> <description>map with bwa</description>
> <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
> <command>
> bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
> <inputs>
> <param format="fastqsanger" name="input" type="data" label="fastq"/>
> </inputs>
> <outputs>
> <data format="sam" name="output" />
> </outputs>
>
> <help>
> bwa
> </help>
>
> </tool>
One minor improvement would be to escape the ">" as ">" in
your XML, or use the CDATA approach documented here:
https://wiki.galaxyproject.org/Tools/BestPractices
> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what may be going on?
> If i don't split the file, everything goes correctly.
This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?
Peter