Hello,

I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:
 https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam

Best regards

On 24 February 2015 at 17:49, Peter Cock <p.j.a.cock@googlemail.com> wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <ralonso@cipf.es> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: ralonso@cipf.es