[galaxy-dev] [hg] galaxy 2588: Merge with 5fa8803716fd7d3250a1a78f5521aa18b3e...

details: http://www.bx.psu.edu/hg/galaxy/rev/070cf5f6f928 changeset: 2588:070cf5f6f928 user: rc date: Thu Aug 20 11:39:32 2009 -0400 description: Merge with 5fa8803716fd7d3250a1a78f5521aa18b3e519b0 13 file(s) affected in this change: lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py lib/galaxy/web/framework/__init__.py templates/admin/requests/grid.mako templates/admin/requests/show_request.mako templates/base_panels.mako templates/history/grid.mako templates/history/list_shared.mako templates/requests/show_request.mako test/base/twilltestcase.py test/functional/test_security_and_libraries.py diffs (truncated from 5056 to 3000 lines): diff -r 881dd4c2de9f -r 070cf5f6f928 datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Thu Aug 20 10:52:08 2009 -0400 +++ b/datatypes_conf.xml.sample Thu Aug 20 11:39:32 2009 -0400 @@ -3,6 +3,7 @@ <registration converters_path="lib/galaxy/datatypes/converters"> <datatype extension="ab1" type="galaxy.datatypes.images:Ab1" mimetype="application/octet-stream" display_in_upload="true"/> <datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/> + <datatype extension="bam" type="galaxy.datatypes.images:Bam" mimetype="application/octet-stream"/> <datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true"> <converter file="bed_to_gff_converter.xml" target_datatype="gff"/> <converter file="interval_to_coverage.xml" target_datatype="coverage"/> @@ -49,6 +50,7 @@ <datatype extension="qualsolexa" type="galaxy.datatypes.qualityscore:QualityScoreSolexa" display_in_upload="true"/> <datatype extension="qualsolid" type="galaxy.datatypes.qualityscore:QualityScoreSOLiD" display_in_upload="true"/> <datatype extension="qual454" type="galaxy.datatypes.qualityscore:QualityScore454" display_in_upload="true"/> + <datatype extension="sam" type="galaxy.datatypes.tabular:Sam" display_in_upload="true"/> <datatype extension="scf" type="galaxy.datatypes.images:Scf" mimetype="application/octet-stream" display_in_upload="true"/> <datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/> <datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/> @@ -205,5 +207,6 @@ <sniffer type="galaxy.datatypes.interval:Gff"/> <sniffer type="galaxy.datatypes.interval:Gff3"/> <sniffer type="galaxy.datatypes.interval:Interval"/> + <sniffer type="galaxy.datatypes.tabular:Sam"/> </sniffers> </datatypes> diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/app.py --- a/lib/galaxy/app.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/app.py Thu Aug 20 11:39:32 2009 -0400 @@ -37,6 +37,8 @@ self.toolbox = tools.ToolBox( self.config.tool_config, self.config.tool_path, self ) # Load datatype converters self.datatypes_registry.load_datatype_converters( self.toolbox ) + #load external metadata tool + self.datatypes_registry.load_external_metadata_tool( self.toolbox ) # Load datatype indexers self.datatypes_registry.load_datatype_indexers( self.toolbox ) #Load security policy diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/coverage.py --- a/lib/galaxy/datatypes/coverage.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/coverage.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,7 +5,7 @@ import pkg_resources pkg_resources.require( "bx-python" ) -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from galaxy.datatypes.sniff import * diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,4 +1,4 @@ -import logging, os, sys, time, sets, tempfile +import logging, os, sys, time, tempfile from galaxy import util from galaxy.util.odict import odict from galaxy.util.bunch import Bunch diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Thu Aug 20 11:39:32 2009 -0400 @@ -12,7 +12,7 @@ august 20 2007 """ -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from cgi import escape diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Thu Aug 20 11:39:32 2009 -0400 @@ -4,6 +4,8 @@ import data import logging +from galaxy.datatypes.metadata import MetadataElement +from galaxy.datatypes import metadata from galaxy.datatypes.sniff import * from urllib import urlencode, quote_plus import zipfile @@ -187,7 +189,7 @@ return 'text/html' def sniff( self, filename ): """ - Determines wether the file is in html format + Determines whether the file is in html format >>> fname = get_test_fname( 'complete.bed' ) >>> Html().sniff( fname ) @@ -233,3 +235,25 @@ return dataset.peek except: return "peek unavailable" + +class Bam( data.Binary ): + """Class describing a BAM binary file""" + file_ext = "bam" + MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True ) + def set_peek( self, dataset ): + if not dataset.dataset.purged: + export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey}) + dataset.peek = "Binary bam alignments file" + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + def display_peek(self, dataset): + try: + return dataset.peek + except: + return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) ) + def get_mime(self): + """Returns the mime type of the datatype""" + return 'application/octet-stream' + \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/interval.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,7 +5,7 @@ import pkg_resources pkg_resources.require( "bx-python" ) -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from galaxy.datatypes.sniff import * diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/registry.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,7 +1,7 @@ """ Provides mapping between extensions and datatypes, mime-types, etc. """ -import os +import os, tempfile import logging import data, tabular, interval, images, sequence, qualityscore, genetics, xml, coverage, tracks, chrominfo import galaxy.util @@ -18,6 +18,7 @@ self.datatype_converters = odict() self.datatype_indexers = odict() self.converters = [] + self.set_external_metadata_tool = None self.indexers = [] self.sniff_order = [] self.upload_file_formats = [] @@ -110,6 +111,7 @@ self.datatypes_by_extension = { 'ab1' : images.Ab1(), 'axt' : sequence.Axt(), + 'bam' : images.Bam(), 'bed' : interval.Bed(), 'binseq.zip' : images.Binseq(), 'blastxml' : xml.BlastXml(), @@ -129,6 +131,7 @@ 'qualsolid' : qualityscore.QualityScoreSOLiD(), 'qualsolexa' : qualityscore.QualityScoreSolexa(), 'qual454' : qualityscore.QualityScore454(), + 'sam' : tabular.Sam(), 'scf' : images.Scf(), 'tabular' : tabular.Tabular(), 'taxonomy' : tabular.Taxonomy(), @@ -139,6 +142,7 @@ self.mimetypes_by_extension = { 'ab1' : 'application/octet-stream', 'axt' : 'text/plain', + 'bam' : 'application/octet-stream', 'bed' : 'text/plain', 'binseq.zip' : 'application/zip', 'blastxml' : 'text/plain', @@ -156,6 +160,7 @@ 'qualsolid' : 'text/plain', 'qualsolexa' : 'text/plain', 'qual454' : 'text/plain', + 'sam' : 'text/plain', 'scf' : 'application/octet-stream', 'tabular' : 'text/plain', 'taxonomy' : 'text/plain', @@ -183,7 +188,8 @@ interval.CustomTrack(), interval.Gff(), interval.Gff3(), - interval.Interval() + interval.Interval(), + tabular.Sam() ] def append_to_sniff_order(): # Just in case any supported data types are not included in the config's sniff_order section. @@ -251,6 +257,31 @@ self.datatype_converters[source_datatype][target_datatype] = converter self.log.debug( "Loaded converter: %s", converter.id ) + def load_external_metadata_tool( self, toolbox ): + """Adds a tool which is used to set external metadata""" + #we need to be able to add a job to the queue to set metadata. The queue will currently only accept jobs with an associated tool. + #We'll create a special tool to be used for Auto-Detecting metadata; this is less than ideal, but effective + #Properly building a tool without relying on parsing an XML file is near impossible...so we'll create a temporary file + tool_xml_text = """ + <tool id="__SET_METADATA__" name="Set External Metadata" version="1.0.0" tool_type="set_metadata"> + <type class="SetMetadataTool" module="galaxy.tools"/> + <action module="galaxy.tools.actions.metadata" class="SetMetadataToolAction"/> + <command>$__SET_EXTERNAL_METADATA_COMMAND_LINE__</command> + <inputs> + <param format="data" name="input1" type="data" label="File to set metadata on."/> + <param name="__ORIGINAL_DATASET_STATE__" type="hidden" value=""/> + <param name="__SET_EXTERNAL_METADATA_COMMAND_LINE__" type="hidden" value=""/> + </inputs> + </tool> + """ + tmp_name = tempfile.NamedTemporaryFile() + tmp_name.write( tool_xml_text ) + tmp_name.flush() + set_meta_tool = toolbox.load_tool( tmp_name.name ) + toolbox.tools_by_id[ set_meta_tool.id ] = set_meta_tool + self.set_external_metadata_tool = set_meta_tool + self.log.debug( "Loaded external metadata tool: %s", self.set_external_metadata_tool.id ) + def load_datatype_indexers( self, toolbox ): """Adds indexers from self.indexers to the toolbox from app""" for elem in self.indexers: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/tabular.py --- a/lib/galaxy/datatypes/tabular.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/tabular.py Thu Aug 20 11:39:32 2009 -0400 @@ -11,6 +11,7 @@ from cgi import escape from galaxy.datatypes import metadata from galaxy.datatypes.metadata import MetadataElement +from sniff import * log = logging.getLogger(__name__) @@ -236,3 +237,84 @@ out = "Can't create peek %s" % exc return out +class Sam( Tabular ): + file_ext = 'sam' + def __init__(self, **kwd): + """Initialize taxonomy datatype""" + Tabular.__init__( self, **kwd ) + self.column_names = ['QNAME', 'FLAG', 'RNAME', 'POS', 'MAPQ', 'CIGAR', + 'MRNM', 'MPOS', 'ISIZE', 'SEQ', 'QUAL', 'OPT' + ] + def make_html_table( self, dataset, skipchars=[] ): + """Create HTML table, used for displaying peek""" + out = ['<table cellspacing="0" cellpadding="3">'] + try: + # Generate column header + out.append( '<tr>' ) + for i, name in enumerate( self.column_names ): + out.append( '<th>%s.%s</th>' % ( str( i+1 ), name ) ) + # This data type requires at least 11 columns in the data + if dataset.metadata.columns - len( self.column_names ) > 0: + for i in range( len( self.column_names ), dataset.metadata.columns ): + out.append( '<th>%s</th>' % str( i+1 ) ) + out.append( '</tr>' ) + out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) ) + out.append( '</table>' ) + out = "".join( out ) + except Exception, exc: + out = "Can't create peek %s" % exc + return out + def sniff( self, filename ): + """ + Determines whether the file is in SAM format + + A file in SAM format consists of lines of tab-separated data. + The following header line may be the first line: + @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL + or + @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT + Data in the OPT column is optional and can consist of tab-separated data + + For complete details see http://samtools.sourceforge.net/SAM1.pdf + + Rules for sniffing as True: + There must be 11 or more columns of data on each line + Columns 2 (FLAG), 4(POS), 5 (MAPQ), 8 (MPOS), and 9 (ISIZE) must be numbers (9 can be negative) + We will only check that up to the first 5 alignments are correctly formatted. + + >>> fname = get_test_fname( 'sequence.maf' ) + >>> Sam().sniff( fname ) + False + >>> fname = get_test_fname( '1.sam' ) + >>> Sam().sniff( fname ) + True + """ + try: + fh = open( filename ) + count = 0 + while True: + line = fh.readline() + line = line.strip() + if not line: + break #EOF + if line: + if line[0] != '@': + linePieces = line.split('\t') + if len(linePieces) < 11: + return False + try: + check = int(linePieces[1]) + check = int(linePieces[3]) + check = int(linePieces[4]) + check = int(linePieces[7]) + check = int(linePieces[8]) + except ValueError: + return False + count += 1 + if count == 5: + return True + if count < 5 and count > 0: + return True + except: + pass + return False diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/test/1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/1.sam Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,97 @@ +@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT +1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(# +1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$ +1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$###### +1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$#### +1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'# +1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&% +1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$### +1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$ +1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#& +1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$# +1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#' +1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$## +1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/ +1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$ +1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$ +1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'# +1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&# +1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$### +1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%# +1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_68_466 69 * 0 0 * * 0 0 GTGATCGTCGGTGCCAGTCCCTGT #(%)+##$#$#%#+$%##$##### +1378_68_466 133 * 0 0 * * 0 0 GTGTCATCTGAGGTAAAGCATTGT /##$09#$#.=$#$76+$%1'### +1378_68_1692 117 chr13.nib:1-114142980 36365609 0 24M = 36365609 0 TTGAACCGGGCACGGGTCTTCTGG #$#######%###$##%&'%)### +1378_68_1692 153 chr13.nib:1-114142980 36365609 37 10M1D13M = 36365609 0 CTGCACATACAGAATATTCATAG 0010/!"0/!!021/132231// XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:10^T13 +1378_80_664 69 * 0 0 * * 0 0 CTGCTTTGATCCCCGGTGGAGCAC 7#%###$$6#######$##$$$## +1378_80_664 133 * 0 0 * * 0 0 TGTCTGCGTTGTATCTCTGGTGTA %##%,%$$#&$$###$#$%##'%# +1378_85_1786 69 * 0 0 * * 0 0 ATACTATGTCGATCTGTAAAAAAA )&.)#3%@$&%-,2#&+.-%0&./ +1378_85_1786 133 * 0 0 * * 0 0 CCCTAGGAGCGTATACCGGACGAG ,'&/%/@,&1,&'/)&,6&&1)(( +1378_86_1011 69 * 0 0 * * 0 0 CTACGTTATTGCTCTGTTTGTCCT ######$%##$$$%###%#$#### +1378_86_1011 133 * 0 0 * * 0 0 AGGCGATGGGATATTATTTTACTT :$###)%##$9$###1$$#$2### +1378_86_1789 89 chr12.nib:1-132349534 39007065 37 23M = 39007065 0 GCTTTCCATAGATGTGTAATTTC J2K]]Z5!GN?@U]]]VX]UYYP XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_86_1789 181 chr12.nib:1-132349534 39007065 0 24M = 39007065 0 ACAACTTAAATAATCATGGACCGG 02,5$$0&6#%?*,$'#%&/15.1 +1378_91_1596 69 * 0 0 * * 0 0 TTAGCGGTTGACTATCTGCTGACA *&+'#9'(%*'#//,&<),/)'*# +1378_91_1596 133 * 0 0 * * 0 0 GCTTTTTCATTCGGTGCCTTTGGA '>%/3%=()8'#.%?50$&5>%)% +1378_94_1595 69 chr7.nib:1-158821424 127518258 0 24M = 127518258 0 CGTGCGACAGCCCATGTTTTCAGA -=..5,3826&*+.+#+#%%6;%# +1378_94_1595 137 chr7.nib:1-158821424 127518258 37 23M = 127518258 0 TGAGATAAACACCTAACATGCTC M]]FN]]\V]]]Q>T]KIG:LVN XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_95_1039 69 * 0 0 * * 0 0 CGGCGTCCATCTTCGCCTTGAGAT $##.#$##$$#%$#$%%$###$)$ +1378_95_1039 133 * 0 0 * * 0 0 GTTCTGTGCCAGGTGAGGTACGGA &##,./#$&)6##+,'#$$0(##$ +1378_95_1767 65 chr11.nib:1-134452384 65333552 25 23M chr3.nib:1-199501827 123725482 0 CAACTGGTGGCATCTGGACAAAC W[[TZYY]]RO<BI7!!:!!>@2 XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_95_1767 129 chr3.nib:1-199501827 123725482 37 6M1I16M chr11.nib:1-134452384 65333552 0 ATTTATCTGTCTCATTCATTATT <AGB8B"!V]]UO/&JB4DE88E XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_96_1037 69 * 0 0 * * 0 0 ATCCCCCAAGATGCCTGTTGATTG $#$'##$$$#%$$#%###+##$#$ +1378_96_1037 133 * 0 0 * * 0 0 CTGCTGGGCCATTTGACTTACTCA '$#+#(##-%5##+*&###-.$$$ +1378_96_1764 81 chr15.nib:1-100338915 89251272 25 23M chr7.nib:1-158821424 19412615 0 AGAAATGGTCGCACCCTCTGGTT E*2ZEHX\SN]O>SYRL):LIOL XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_96_1764 161 chr7.nib:1-158821424 19412615 37 23M chr15.nib:1-100338915 89251272 0 GTATAGCCCACAACGCCTAATAT ZMBS]UW]UYR\]QPZ[SMYL7C XT:A:U CM:i:0 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_98_1574 69 * 0 0 * * 0 0 GTTCTGCCGGTGTCTGTGGCGGGC $$#+&$$####%$$$###$%#%%# +1378_98_1574 133 * 0 0 * * 0 0 AGGCGAGTGTGGGGGTTGTTTGAG +%%$#)##%##$####%###$%$# +1378_107_1647 69 * 0 0 * * 0 0 AGGCCTACTACGCGTCATTGATAG &#$$#$(.#%#$$####&$%##($ +1378_107_1647 133 * 0 0 * * 0 0 GGTCTGGTTCTATGTTGGTCGACT ###'$$#$$$(#%###(#$##$%# +1378_111_829 69 chr9.nib:1-140273252 82506894 0 24M = 82506894 0 TGCGGCACTTGCTTCTTCGTATTT %#%##%#$%#$#%###$$##&#$$ +1378_111_829 137 chr9.nib:1-140273252 82506894 37 4M1I18M = 82506894 0 GATGCGTAATCTAGTAAAATAAG 0/362//00/5516500210451 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_111_1900 69 * 0 0 * * 0 0 TCCCCTCGCTCGGCTCTGTGCTGT $&%*$#(#)##$#'##%(##$#$% +1378_111_1900 133 * 0 0 * * 0 0 GCACGCCTTTGGGCTAAGCCGTAA )$)'#%$########$'#&%$#(# +1378_112_1483 69 * 0 0 * * 0 0 TGTCCAGCTATGCGGCTTCCTCCT %#$+#%#&#$#####%####%$## +1378_112_1483 133 * 0 0 * * 0 0 TGGAGTGGTGTGTTTGCTGAGCCA #$#)#############$#%#%'% +1378_125_1287 69 * 0 0 * * 0 0 TGTCTCTGGGGGGCCTGGTTAGGT $##13$'%#$###$$###$$$#&# +1378_125_1287 133 * 0 0 * * 0 0 TGACGTGGGTTGTCCCGTGAGATT ##$%%#$###$##$$#&%##$(%% +1378_126_468 117 chr11.nib:1-134452384 72541052 0 24M = 72541052 0 TGCCTCTATACAGATTAGTCCTCT )7,7..?97594@8=,=?813@>7 +1378_126_468 153 chr11.nib:1-134452384 72541052 0 23M = 72541052 0 AGGCAAGACTCTGTCTCAAAAAA PK5G]]PDT\]SEXY[]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:15713 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_127_664 69 * 0 0 * * 0 0 AGAGGTTGGTGTCTTGTCGCAGCT ##'#$######$$%######$$$# +1378_127_664 133 * 0 0 * * 0 0 TCGCTTTGCCTATGTTTGTTCGGA #%$%#&##$%#%%###$$###)-' +1378_129_463 97 chr8.nib:1-146274826 29931771 37 23M chr19.nib:1-63811651 5702213 0 GTAGCTCTGTTTCACATTAGGGG J>AQ[G>C?NM:GD=)*PLORIF XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_129_463 145 chr19.nib:1-63811651 5702213 0 23M chr8.nib:1-146274826 29931771 0 AAAAAAAAAAAAAAAAAAAAAAA JOI:AHGD==@KQB78HF>KA8> XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:583698 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_129_875 69 * 0 0 * * 0 0 TTTCTATGGCTTACGCTGTCTGCC #$($##%####%$#$#####$### +1378_129_875 133 * 0 0 * * 0 0 GACCTTTACGTATTGGGGGTTGGC ###)###+###$##$#&%##$,#$ +1378_140_1251 69 * 0 0 * * 0 0 ATCCTAGCGCGGTGTCTTGGGGAC #$%1#$$$##$##$#$#$##$%$$ +1378_140_1251 133 * 0 0 * * 0 0 TTTCCTTCGTGTGCGTGCGGAGTG #%#%$##$$$######.$$$%#%( +1378_141_809 69 * 0 0 * * 0 0 TGTCCTCCAGTGTCTGTTGGGTGT %&,-##$$#(%###$#$$'###'# +1378_141_809 133 * 0 0 * * 0 0 TCTCGTGGTTTCTTTTTTATGTGT ##%)##$$#####%$#$#%%#'## +1378_144_983 69 * 0 0 * * 0 0 AGCGCCCGGTTGGTGCGGCTCGTC -$(&%*$#*#))#$$$#%%$#$## +1378_144_983 133 * 0 0 * * 0 0 GTTCGTTCGTGGTGTACGAGGGTG #(#%#####($#%##$$#%##%#) +1378_153_270 69 * 0 0 * * 0 0 AGTCCTTGTCCCCTGGGTTTTCCC +''$#&%$%#$##&$$($#&#$$# +1378_153_270 133 * 0 0 * * 0 0 GGCCGTGTGCGGGTGTAGATTGGA %$##($######&##$&$$$$%## +1378_155_1689 65 chrX.nib:1-154913754 106941539 37 23M = 106940385 -1154 ATCTCCTCTTCCTTCCATTCCAC \]]]Y]]]]]UV]]]ZYZZ]]RV XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_155_1689 129 chrX.nib:1-154913754 106940385 37 23M = 106941539 1154 GACTATGAGGTTTTCATTCAACA ]]]]\\]]]YW]]]WRZ]]WIOK XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_157_1580 69 * 0 0 * * 0 0 TGGGCCTCGGTGCCCTTGGTCTGT #%)$##'#$$$&#####%#$#$## +1378_157_1580 133 * 0 0 * * 0 0 GGGATTGAAGGGATGTATGCTAGG #%$&%#$$'%$%#$##*#%$$$$# +1378_161_317 69 * 0 0 * * 0 0 TTGGCCGGCAACCCCGGTACCTAA 7<,<'@)@>.)2@/')'&(?/-<( +1378_161_317 133 * 0 0 * * 0 0 AATCCATACCCACAAAAGCAGGCC .&%','(@''?7//+&)+2.+)0) +1378_177_735 113 chr2.nib:1-242951149 222173182 25 23M = 222173882 700 TTGTTCAGCGCCGATTGTCAATC KPNICFMS]]]Z]]]]Y]]]]]] XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:1G21 +1378_177_735 177 chr2.nib:1-242951149 222173882 37 23M = 222173182 -700 AGAATTCCTAACAAAATGTGAAG ES6-]]]]]]]]]]]]]]]]]]] XT:A:U CM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_181_1684 69 * 0 0 * * 0 0 CGACTCCCGCATTCACGGTCAAGT &*#,##$#&$*$$#$#$$$#%$## +1378_181_1684 133 * 0 0 * * 0 0 TTTCTGTTGTGGTTTTGTTGGGGT $##'$%'##%##$%$#$$####$* +1378_187_1407 69 * 0 0 * * 0 0 TGGCGTCCACTCGTGGGTCTATCG $#$'%#$%$%&$%#####$#$#%# +1378_187_1407 133 * 0 0 * * 0 0 TTGGGTGAAATCTTGTCGAGTGGA ####&##$$###$#####%##%%) +1378_203_721 97 chr1.nib:1-247249719 245680524 25 23M chr2.nib:1-242951149 213173999 0 GTAAAATTTGTGGAGATTTAAGT ]VEFFEZ]XPW]TOVINQ,;T!! XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_203_721 145 chr2.nib:1-242951149 213173999 37 4M1I18M chr1.nib:1-247249719 245680524 0 ACCTAACAAAATTGTTCAATATG F>8AWT<AV]Q9B"+]O@IF=K] XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_206_2039 113 chr4.nib:1-191273063 103793427 0 23M chr18.nib:1-76117153 57165542 0 ACACACACACACACACACACACA NKWZVWZ]]XV[]]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_206_2039 177 chr18.nib:1-76117153 57165542 0 23M chr4.nib:1-191273063 103793427 0 CACACACACACACACACACACAC NAJ[SPT[]]]W[]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/jobs/__init__.py --- a/lib/galaxy/jobs/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/jobs/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -274,7 +274,7 @@ elif idata.state == idata.states.ERROR: job_wrapper.fail( "input data %d is in error state" % ( idata.hid ) ) return JOB_INPUT_ERROR - elif idata.state != idata.states.OK: + elif idata.state != idata.states.OK and not ( idata.state == idata.states.SETTING_METADATA and job.tool_id is not None and job.tool_id == self.app.datatypes_registry.set_external_metadata_tool.id ): # need to requeue return JOB_WAIT return JOB_READY @@ -543,7 +543,7 @@ # Certain tools require tasks to be completed after job execution # ( this used to be performed in the "exec_after_process" hook, but hooks are deprecated ). if self.tool.tool_type is not None: - self.tool.exec_after_process( self.queue.app, inp_data, out_data, param_dict ) + self.tool.exec_after_process( self.queue.app, inp_data, out_data, param_dict, job = job ) # Call 'exec_after_process' hook self.tool.call_hook( 'exec_after_process', self.queue.app, inp_data=inp_data, out_data=out_data, param_dict=param_dict, diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/jobs/runners/local.py --- a/lib/galaxy/jobs/runners/local.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/jobs/runners/local.py Thu Aug 20 11:39:32 2009 -0400 @@ -104,7 +104,7 @@ #run the metadata setting script here #this is terminatable when output dataset/job is deleted #so that long running set_meta()s can be cancelled without having to reboot the server - if job_wrapper.get_state() not in [ model.Job.states.ERROR, model.Job.states.DELETED ] and self.app.config.set_metadata_externally: + if job_wrapper.get_state() not in [ model.Job.states.ERROR, model.Job.states.DELETED ] and self.app.config.set_metadata_externally and job_wrapper.output_paths: external_metadata_script = job_wrapper.setup_external_metadata( output_fnames = job_wrapper.get_output_fnames(), kwds = { 'overwrite' : False } ) #we don't want to overwrite metadata that was copied over in init_meta(), as per established behavior log.debug( 'executing external set_meta script for job %d: %s' % ( job_wrapper.job_id, external_metadata_script ) ) external_metadata_proc = subprocess.Popen( args = external_metadata_script, diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/model/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,8 +5,7 @@ the relationship cardinalities are obvious (e.g. prefer Dataset to Data) """ -import os.path, os, errno -import sha +import os.path, os, errno, sys import galaxy.datatypes from galaxy.util.bunch import Bunch from galaxy import util @@ -14,8 +13,7 @@ import galaxy.datatypes.registry from galaxy.datatypes.metadata import MetadataCollection from galaxy.security import RBACAgent, get_permitted_actions - - +from galaxy.util.hash_util import * import logging log = logging.getLogger( __name__ ) @@ -40,10 +38,10 @@ def set_password_cleartext( self, cleartext ): """Set 'self.password' to the digest of 'cleartext'.""" - self.password = sha.new( cleartext ).hexdigest() + self.password = new_secure_hash( text_type=cleartext ) def check_password( self, cleartext ): """Check if 'cleartext' matches 'self.password' when hashed.""" - return self.password == sha.new( cleartext ).hexdigest() + return self.password == new_secure_hash( text_type=cleartext ) def all_roles( self ): roles = [ ura.role for ura in self.roles ] for group in [ uga.group for uga in self.groups ]: @@ -330,7 +328,8 @@ OK = 'ok', EMPTY = 'empty', ERROR = 'error', - DISCARDED = 'discarded' ) + DISCARDED = 'discarded', + SETTING_METADATA = 'setting_metadata' ) permitted_actions = get_permitted_actions( filter='DATASET' ) file_path = "/tmp/" engine = None diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/tools/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,15 +1,13 @@ """ Classes encapsulating galaxy tools and tool configuration. """ - import pkg_resources; pkg_resources.require( "simplejson" ) import logging, os, string, sys, tempfile, glob, shutil import simplejson -import sha, hmac, binascii - +import binascii from UserDict import DictMixin from galaxy.util.odict import odict from galaxy.util.bunch import Bunch @@ -26,6 +24,7 @@ from galaxy.util.none_like import NoneDataset from galaxy.datatypes import sniff from cgi import FieldStorage +from galaxy.util.hash_util import * log = logging.getLogger( __name__ ) @@ -211,7 +210,7 @@ value["__page__"] = self.page value = simplejson.dumps( value ) # Make it secure - a = hmac.new( app.config.tool_secret, value, sha ).hexdigest() + a = hmac_new( app.config.tool_secret, value ) b = binascii.hexlify( value ) return "%s:%s" % ( a, b ) def decode( self, value, tool, app ): @@ -221,7 +220,7 @@ # Extract and verify hash a, b = value.split( ":" ) value = binascii.unhexlify( b ) - test = hmac.new( app.config.tool_secret, value, sha ).hexdigest() + test = hmac_new( app.config.tool_secret, value ) assert a == test # Restore from string values = json_fix( simplejson.loads( value ) ) @@ -453,7 +452,6 @@ self.tests = None # Determine if this tool can be used in workflows self.is_workflow_compatible = self.check_workflow_compatible() - def parse_inputs( self, root ): """ @@ -1468,7 +1466,7 @@ out_data[ name ] = data return out_data - def exec_after_process( self, app, inp_data, out_data, param_dict ): + def exec_after_process( self, app, inp_data, out_data, param_dict, job = None ): if self.tool_type == 'data_source': name, data = out_data.items()[0] data.set_size() @@ -1572,6 +1570,18 @@ dataset.history.add( new_data ) new_data.flush() return primary_datasets + +class SetMetadataTool( Tool ): + def exec_after_process( self, app, inp_data, out_data, param_dict, job = None ): + for name, dataset in inp_data.iteritems(): + external_metadata = galaxy.datatypes.metadata.JobExternalOutputMetadataWrapper( job ) + if external_metadata.external_metadata_set_successfully( dataset ): + dataset.metadata.from_JSON_dict( external_metadata.get_output_filenames_by_dataset( dataset ).filename_out ) + # If setting external metadata has failed, how can we inform the user? + # For now, we'll leave the default metadata and set the state back to its original. + dataset.datatype.after_edit( dataset ) + dataset.state = param_dict.get( '__ORIGINAL_DATASET_STATE__' ) + dataset.flush() # ---- Utility classes to be factored out ----------------------------------- diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/tools/actions/metadata.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/tools/actions/metadata.py Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,48 @@ +from __init__ import ToolAction +from galaxy.datatypes.metadata import JobExternalOutputMetadataWrapper + +import logging +log = logging.getLogger( __name__ ) + +class SetMetadataToolAction( ToolAction ): + """Tool action used for setting external metadata on an existing dataset""" + + def execute( self, tool, trans, incoming = {}, set_output_hid = False ): + for name, value in incoming.iteritems(): + if isinstance( value, trans.app.model.HistoryDatasetAssociation ): + dataset = value + dataset_name = name + break + else: + raise Exception( 'The dataset to set metadata on could not be determined.' ) + + # Create the job object + job = trans.app.model.Job() + job.session_id = trans.get_galaxy_session().id + job.history_id = trans.history.id + job.tool_id = tool.id + try: + # For backward compatibility, some tools may not have versions yet. + job.tool_version = tool.version + except: + job.tool_version = "1.0.0" + job.flush() #ensure job.id is available + + #add parameters to job_parameter table + incoming[ '__ORIGINAL_DATASET_STATE__' ] = dataset.state #store original dataset state, so we can restore it. A seperate table might be better (no chance of 'loosing' the original state)? + external_metadata_wrapper = JobExternalOutputMetadataWrapper( job ) + cmd_line = external_metadata_wrapper.setup_external_metadata( dataset, exec_dir = None, tmp_dir = trans.app.config.new_file_path, dataset_files_path = trans.app.model.Dataset.file_path, output_fnames = None, config_root = None, datatypes_config = None, kwds = { 'overwrite' : True } ) + incoming[ '__SET_EXTERNAL_METADATA_COMMAND_LINE__' ] = cmd_line + for name, value in tool.params_to_strings( incoming, trans.app ).iteritems(): + job.add_parameter( name, value ) + #add the dataset to job_to_input_dataset table + job.add_input_dataset( dataset_name, dataset ) + #Need a special state here to show that metadata is being set and also allow the job to run + # i.e. if state was set to 'running' the set metadata job would never run, as it would wait for input (the dataset to set metadata on) to be in a ready state + dataset.state = dataset.states.SETTING_METADATA + trans.app.model.flush() + + # Queue the job for execution + trans.app.job_queue.put( job.id, tool ) + trans.log_event( "Added set external metadata job to the job queue, id: %s" % str(job.id), tool_id=job.tool_id ) + return [] diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,4 +1,5 @@ import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile +from __init__ import ToolAction from galaxy import datatypes, jobs from galaxy.datatypes import sniff from galaxy import model, util @@ -8,7 +9,7 @@ import logging log = logging.getLogger( __name__ ) -class UploadToolAction( object ): +class UploadToolAction( ToolAction ): # Action for uploading files def __init__( self ): self.empty = False diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/util/hash_util.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/util/hash_util.py Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,28 @@ +import sys, logging +using_24 = sys.version_info[:2] < ( 2, 5 ) +if using_24: + import sha +else: + import hashlib +import hmac + +log = logging.getLogger( __name__ ) + +""" +Utility functions for bi-directional Python version compatibility. Python 2.5 +introduced hashlib which replaced sha in Python 2.4 and previous versions. +""" +def new_secure_hash( text_type=None ): + if using_24: + if text_type: + return sha.new( text_type ).hexdigest() + return sha.new() + else: + if text_type: + return hashlib.sha1( text_type ).hexdigest() + return hashlib.sha1() +def hmac_new( key, value ): + if using_24: + return hmac.new( key, value, sha ).hexdigest() + else: + return hmac.new( key, value, hashlib.sha1 ).hexdigest() diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,9 +1,14 @@ -import shutil, StringIO, operator, urllib, gzip, tempfile, sets, string, sys +import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys from datetime import datetime, timedelta from galaxy import util, datatypes from galaxy.web.base.controller import * from galaxy.model.orm import * from galaxy.web.controllers.forms import get_all_forms, get_form_widgets +# Older py compatibility +try: + set() +except: + from sets import Set as set import logging log = logging.getLogger( __name__ ) @@ -1206,7 +1211,6 @@ template = info_association.template # See if we have any field contents info = info_association.info - log.debug("####In library_dataset_dataset_association, info.content: %s" % str( info.content)) if info: widgets = get_form_widgets( trans, template, info.content ) else: @@ -1225,16 +1229,16 @@ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: if len( in_roles ) > 1: # Get the set of all users that are being associated with the dataset - in_roles_set = sets.Set() + in_roles_set = set() for role in in_roles: in_roles_set.add( role ) - users_set = sets.Set() + users_set = set() for role in in_roles: for ura in role.users: users_set.add( ura.user ) # Make sure that at least 1 user has every role being associated with the dataset for user in users_set: - user_roles_set = sets.Set() + user_roles_set = set() for ura in user.roles: user_roles_set.add( ura.role ) if in_roles_set.issubset( user_roles_set ): @@ -1410,16 +1414,16 @@ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: if len( in_roles ) > 1: # Get the set of all users that are being associated with the dataset - in_roles_set = sets.Set() + in_roles_set = set() for role in in_roles: in_roles_set.add( role ) - users_set = sets.Set() + users_set = set() for role in in_roles: for ura in role.users: users_set.add( ura.user ) # Make sure that at least 1 user has every role being associated with the dataset for user in users_set: - user_roles_set = sets.Set() + user_roles_set = set() for ura in user.roles: user_roles_set.add( ura.role ) if in_roles_set.issubset( user_roles_set ): diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/async.py --- a/lib/galaxy/web/controllers/async.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/async.py Thu Aug 20 11:39:32 2009 -0400 @@ -6,8 +6,8 @@ from galaxy import jobs, util, datatypes, web -import logging, urllib -import sha, hmac +import logging, urllib, sys +from galaxy.util.hash_util import * log = logging.getLogger( __name__ ) @@ -58,7 +58,7 @@ return "Data %s does not exist or has already been deleted" % data_id if STATUS == 'OK': - key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest() + key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) ) if key != data_secret: return "You do not have permission to alter data %s." % data_id # push the job into the queue @@ -116,7 +116,7 @@ trans.log_event( "Added dataset %d to history %d" %(data.id, trans.history.id ), tool_id=tool_id ) try: - key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest() + key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) ) galaxy_url = trans.request.base + '/async/%s/%s/%s' % ( tool_id, data.id, key ) params.update( { 'GALAXY_URL' :galaxy_url } ) params.update( { 'data_id' :data.id } ) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,4 +1,4 @@ -import logging, os, sets, string, shutil, re, socket, mimetypes, smtplib, urllib +import logging, os, string, shutil, re, socket, mimetypes, smtplib, urllib from galaxy.web.base.controller import * from galaxy import util, datatypes, jobs, web, model diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/genetrack.py --- a/lib/galaxy/web/controllers/genetrack.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/genetrack.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,11 +1,10 @@ -import time, glob, os +import time, glob, os, sys from itertools import cycle -import sha - from mako import exceptions from mako.template import Template from mako.lookup import TemplateLookup from galaxy.web.base.controller import * +from galaxy.util.hash_util import * try: import pkg_resources @@ -265,7 +264,7 @@ tmpl_name, track_maker = conf.PLOT_MAPPER[param.plot] # check against a hash, display an image that already exists if it was previously created. - hash = sha.new() + hash = new_secure_hash() hash.update(str(dataset_id)) for key in sorted(kwds.keys()): hash.update(str(kwds[key])) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Thu Aug 20 11:39:32 2009 -0400 @@ -12,7 +12,6 @@ # States for passing messages SUCCESS, INFO, WARNING, ERROR = "done", "info", "warning", "error" - class HistoryListGrid( grids.Grid ): # Custom column types @@ -70,8 +69,43 @@ def apply_default_filter( self, trans, query ): return query.filter_by( user=trans.user, purged=False ) +class SharedHistoryListGrid( grids.Grid ): + # Custom column types + class DatasetsByStateColumn( grids.GridColumn ): + def get_value( self, trans, grid, history ): + rval = [] + for state in ( 'ok', 'running', 'queued', 'error' ): + total = sum( 1 for d in history.active_datasets if d.state == state ) + if total: + rval.append( '<div class="count-box state-color-%s">%s</div>' % ( state, total ) ) + else: + rval.append( '' ) + return rval + class SharedByColumn( grids.GridColumn ): + def get_value( self, trans, grid, history ): + return history.user.email + # Grid definition + title = "Histories shared with you by others" + model_class = model.History + default_sort_key = "-update_time" + columns = [ + grids.GridColumn( "Name", key="name" ), + DatasetsByStateColumn( "Datasets (by state)", ncells=4 ), + grids.GridColumn( "Created", key="create_time", format=time_ago ), + grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), + SharedByColumn( "Shared by", key="user_id" ) + ] + operations = [ + grids.GridOperation( "Clone" ), + grids.GridOperation( "Unshare" ) + ] + standard_filters = [] + def build_initial_query( self, session ): + return session.query( self.model_class ).join( 'users_shared_with' ) + def apply_default_filter( self, trans, query ): + return query.filter( model.HistoryUserShareAssociation.user == trans.user ) + class HistoryController( BaseController ): - @web.expose def index( self, trans ): return "" @@ -80,7 +114,8 @@ """XML history list for functional tests""" return trans.fill_template( "/history/list_as_xml.mako" ) - list_grid = HistoryListGrid() + stored_list_grid = HistoryListGrid() + shared_list_grid = SharedHistoryListGrid() @web.expose @web.require_login( "work with multiple histories" ) @@ -91,7 +126,6 @@ if 'operation' in kwargs: history_ids = util.listify( kwargs.get( 'id', [] ) ) histories = [] - shared_by_others = [] operation = kwargs['operation'].lower() if operation == "share": return self.share( trans, **kwargs ) @@ -127,7 +161,7 @@ status, message = self._list_undelete( trans, histories ) trans.sa_session.flush() # Render the list view - return self.list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) + return self.stored_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) def _list_delete( self, trans, histories ): """Delete histories""" n_deleted = 0 @@ -195,18 +229,38 @@ # No message return None, None @web.expose - def list_shared( self, trans, **kwd ): + def list_shared( self, trans, **kwargs ): """List histories shared with current user by others""" - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - shared_by_others = trans.sa_session \ - .query( model.HistoryUserShareAssociation ) \ - .filter_by( user=trans.user ) \ - .join( 'history' ) \ - .filter( model.History.deleted == False ) \ - .order_by( desc( model.History.update_time ) ) \ - .all() - return trans.fill_template( "/history/list_shared.mako", shared_by_others=shared_by_others, msg=msg, messagetype='done' ) + msg = util.restore_text( kwargs.get( 'msg', '' ) ) + status = message = None + if 'operation' in kwargs: + id = kwargs.get( 'id', None ) + operation = kwargs['operation'].lower() + if operation == "clone": + if not id: + message = "Select a history to clone" + return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs ) + # When cloning shared histories, only copy active datasets + new_kwargs = { 'clone_choice' : 'active' } + return self.clone( trans, id, **new_kwargs ) + elif operation == 'unshare': + if not id: + message = "Select a history to unshare" + return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs ) + ids = util.listify( id ) + histories = [] + for history_id in ids: + history = get_history( trans, history_id, check_ownership=False ) + histories.append( history ) + for history in histories: + # Current user is the user with which the histories were shared + association = trans.app.model.HistoryUserShareAssociation.filter_by( user=trans.user, history=history ).one() + association.delete() + association.flush() + message = "Unshared %d shared histories" % len( ids ) + status = 'done' + # Render the list view + return self.shared_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) @web.expose def delete_current( self, trans ): """Delete just the active history -- this does not require a logged in user.""" @@ -323,6 +377,9 @@ can_change, cannot_change, no_change_needed, unique_no_change_needed, send_to_err = \ self._populate_restricted( trans, user, histories, send_to_users, None, send_to_err, unique=True ) send_to_err += err_msg + if cannot_change and not no_change_needed and not can_change: + send_to_err = "The histories you are sharing do not contain any datasets that can be accessed by the users with which you are sharing." + return trans.fill_template( "/history/share.mako", histories=histories, email=email, send_to_err=send_to_err ) if can_change or cannot_change: return trans.fill_template( "/history/share.mako", histories=histories, @@ -350,8 +407,6 @@ email=email, err_msg=err_msg, share_button=True ) ) - if action == "no_share": - trans.response.send_redirect( url_for( controller='root', action='history_options' ) ) user = trans.get_user() histories, send_to_users, send_to_err = self._get_histories_and_users( trans, user, id, email ) send_to_err = '' @@ -629,29 +684,38 @@ @web.expose @web.require_login( "clone shared Galaxy history" ) def clone( self, trans, id, **kwd ): - history = get_history( trans, id, check_ownership=False ) + """Clone a list of histories""" params = util.Params( kwd ) + ids = util.listify( id ) + histories = [] + for history_id in ids: + history = get_history( trans, history_id, check_ownership=False ) + histories.append( history ) clone_choice = params.get( 'clone_choice', None ) if not clone_choice: return trans.fill_template( "/history/clone.mako", history=history ) user = trans.get_user() - if history.user == user: - owner = True + for history in histories: + if history.user == user: + owner = True + else: + if trans.sa_session.query( trans.app.model.HistoryUserShareAssociation ) \ + .filter_by( user=user, history=history ).count() == 0: + return trans.show_error_message( "The history you are attempting to clone is not owned by you or shared with you. " ) + owner = False + name = "Clone of '%s'" % history.name + if not owner: + name += " shared by '%s'" % history.user.email + if clone_choice == 'activatable': + new_history = history.copy( name=name, target_user=user, activatable=True ) + elif clone_choice == 'active': + name += " (active items only)" + new_history = history.copy( name=name, target_user=user ) + if len( histories ) == 1: + msg = 'Clone with name "%s" is now included in your previously stored histories.' % new_history.name else: - if trans.sa_session.query( trans.app.model.HistoryUserShareAssociation ) \ - .filter_by( user=user, history=history ).count() == 0: - return trans.show_error_message( "The history you are attempting to clone is not owned by you or shared with you. " ) - owner = False - name = "Clone of '%s'" % history.name - if not owner: - name += " shared by '%s'" % history.user.email - if clone_choice == 'activatable': - new_history = history.copy( name=name, target_user=user, activatable=True ) - elif clone_choice == 'active': - name += " (active items only)" - new_history = history.copy( name=name, target_user=user ) - # Render the list view - return trans.show_ok_message( 'Clone with name "%s" is now included in your list of stored histories.' % new_history.name ) + msg = '%d cloned histories are now included in your previously stored histories.' % len( histories ) + return trans.show_ok_message( msg ) ## ---- Utility methods ------------------------------------------------------- diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Thu Aug 20 11:39:32 2009 -0400 @@ -465,7 +465,7 @@ msg=util.sanitize_text( msg ), messagetype='error' ) ) # See if we have any associated templates - info_association = folder.get_info_association() + info_association = ldda.get_info_association() if info_association: template = info_association.template # See if we have any field contents diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Thu Aug 20 11:39:32 2009 -0400 @@ -147,16 +147,12 @@ helptext='')) # library associated if request.library: - request_details.append(dict(label='Library', - value=request.library.name, - helptext='Associated library where the resultant \ - dataset will be stored')) + value = request.library.name else: - request_details.append(dict(label='Library', - value=None, - helptext='Associated library where the resultant \ - dataset will be stored')) - + value = None + request_details.append( dict( label='Data library', + value=value, + helptext='Data library where the resultant dataset will be stored' ) ) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: @@ -489,18 +485,17 @@ else: lib_list.add_option(lib.name, lib.id) if lib_id == 'new': - lib_list.add_option('Create a new library', 'new', selected=True) + lib_list.add_option('Create a new data library', 'new', selected=True) else: - lib_list.add_option('Create a new library', 'new') - widget = dict(label='Library', + lib_list.add_option('Create a new data library', 'new') + widget = dict(label='Data library', widget=lib_list, - helptext='Associated library where the resultant \ - dataset will be stored.') + helptext='Data library where the resultant dataset will be stored.') if lib_id == 'new': - new_lib = dict(label='Create a new Library', + new_lib = dict(label='Create a new data library', widget=TextField('new_library_name', 40, util.restore_text( params.get( 'new_library_name', '' ) )), - helptext='Enter a library name here to request a new library') + helptext='Enter a name here to request a new data library') return [widget, new_lib] else: return [widget] @@ -510,7 +505,7 @@ ''' empty_fields = [] # if not request.library: -# empty_fields.append('Library') +# empty_fields.append('Data library') # check rest of the fields of the form for index, field in enumerate(request.type.request_form.fields): if field['required'] == 'required' and request.values.content[index] in ['', None]: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 11:39:32 2009 -0400 @@ -544,15 +544,12 @@ helptext='')) # library associated if request.library: - request_details.append(dict(label='Library', - value=request.library.name, - helptext='Associated library where the resultant \ - dataset will be stored')) + value=request.library.name else: - request_details.append(dict(label='Library', - value=None, - helptext='Associated library where the resultant \ - dataset will be stored')) + value = None + request_details.append(dict(label='Data library', + value=value, + helptext='Data library where the resultant dataset will be stored')) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,7 +1,7 @@ """ Contains the main interface in the Universe class """ -import logging, os, sets, string, shutil, urllib, re, socket +import logging, os, string, shutil, urllib, re, socket from cgi import escape, FieldStorage from galaxy import util, datatypes, jobs, web, util from galaxy.web.base.controller import * @@ -60,7 +60,6 @@ trans.response.set_content_type('text/xml') return trans.fill_template_mako( "root/history_as_xml.mako", history=history, show_deleted=util.string_as_bool( show_deleted ) ) else: - template = "root/history.mako" show_deleted = util.string_as_bool( show_deleted ) query = trans.sa_session.query( model.HistoryDatasetAssociation ) \ .filter( model.HistoryDatasetAssociation.history == history ) \ @@ -297,10 +296,15 @@ if name not in [ 'name', 'info', 'dbkey' ]: if spec.get( 'default' ): setattr( data.metadata, name, spec.unwrap( spec.get( 'default' ) ) ) - data.set_meta() - data.datatype.after_edit( data ) + if trans.app.config.set_metadata_externally: + msg = 'Attributes have been queued to be updated' + trans.app.datatypes_registry.set_external_metadata_tool.tool_action.execute( trans.app.datatypes_registry.set_external_metadata_tool, trans, incoming = { 'input1':data } ) + else: + msg = 'Attributes updated' + data.set_meta() + data.datatype.after_edit( data ) trans.app.model.flush() - return trans.show_ok_message( "Attributes updated", refresh_frames=['history'] ) + return trans.show_ok_message( msg, refresh_frames=['history'] ) elif params.convert_data: target_type = kwd.get("target_type", None) if target_type: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/tool_runner.py --- a/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,6 +5,7 @@ from galaxy.web.base.controller import * from galaxy.util.bunch import Bunch from galaxy.tools import DefaultToolState +from galaxy.tools.parameters.basic import UnvalidatedValue import logging log = logging.getLogger( __name__ ) @@ -52,15 +53,84 @@ add_frame.wiki_url = trans.app.config.wiki_url add_frame.from_noframe = True return trans.fill_template( template, history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars ) - + + @web.expose + def rerun( self, trans, id=None, from_noframe=None, **kwd ): + """ + Given a HistoryDatasetAssociation id, find the job and that created + the dataset, extract the parameters, and display the appropriate tool + form with parameters already filled in. + """ + if not id: + error( "'id' parameter is required" ); + try: + id = int( id ) + except: + error( "Invalid value for 'id' parameter" ) + # Get the dataset object + data = trans.app.model.HistoryDatasetAssociation.get( id ) + # Get the associated job, if any. If this hda was copied from another, + # we need to find the job that created the origial hda + job_hda = data + while job_hda.copied_from_history_dataset_association: + job_hda = job_hda.copied_from_history_dataset_association + if not job_hda.creating_job_associations: + error( "Could not find the job for this dataset" ) + # Get the job object + job = None + for assoc in job_hda.creating_job_associations: + job = assoc.job + break + if not job: + raise Exception("Failed to get job information for dataset hid %d" % hid) + # Get the tool object + tool_id = job.tool_id + try: + # Load the tool + toolbox = self.get_toolbox() + tool = toolbox.tools_by_id.get( tool_id, None ) + except: + #this is expected, so not an exception + error( "This dataset was created by an obsolete tool (%s). Can't re-run." % tool_id ) + # Can't rerun upload, external data sources, et cetera. Workflow + # compatible will proxy this for now + if not tool.is_workflow_compatible: + error( "The '%s' tool does not currently support rerunning." % tool.name ) + # Get the job's parameters + try: + params_objects = job.get_param_values( trans.app ) + except: + raise Exception( "Failed to get paramemeters for dataset id %d " % hid ) + # Unpack unvalidated values to strings, they'll be validated when the + # form is submitted (this happens when re-running a job that was + # initially run by a workflow) + validated_params = {} + for name, value in params_objects.items(): + if isinstance( value, UnvalidatedValue ): + validated_params [ str(name) ] = str(value) + else: + validated_params [ str(name) ] = value + params_objects = validated_params + # Create a fake tool_state for the tool, with the parameters values + state = tool.new_state( trans ) + state.inputs = params_objects + tool_state_string = util.object_to_string(state.encode(tool, trans.app)) + # Setup context for template + history = trans.get_history() + vars = dict( tool_state=state, errors = {} ) + # Is the "add frame" stuff neccesary here? + add_frame = AddFrameData() + add_frame.debug = trans.debug + if from_noframe is not None: + add_frame.wiki_url = trans.app.config.wiki_url + add_frame.from_noframe = True + return trans.fill_template( "tool_form.mako", history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars ) @web.expose def redirect( self, trans, redirect_url=None, **kwd ): if not redirect_url: return trans.show_error_message( "Required URL for redirection missing" ) trans.log_event( "Redirecting to: %s" % redirect_url ) return trans.fill_template( 'root/redirect.mako', redirect_url=redirect_url ) - - @web.json def upload_async_create( self, trans, tool_id=None, **kwd ): """ diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/form_builder.py --- a/lib/galaxy/web/form_builder.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/form_builder.py Thu Aug 20 11:39:32 2009 -0400 @@ -3,6 +3,7 @@ """ import logging,sys +from cgi import escape log = logging.getLogger(__name__) class BaseField(object): @@ -28,7 +29,7 @@ self.value = value or "" def get_html( self, prefix="" ): return '<input type="text" name="%s%s" size="%d" value="%s">' \ - % ( prefix, self.name, self.size, self.value ) + % ( prefix, self.name, self.size, escape(str(self.value), quote=True) ) def set_size(self, size): self.size = int( size ) @@ -49,7 +50,7 @@ self.value = value or "" def get_html( self, prefix="" ): return '<textarea name="%s%s" rows="%d" cols="%d">%s</textarea>' \ - % ( prefix, self.name, self.rows, self.cols, self.value ) + % ( prefix, self.name, self.rows, self.cols, escape(str(self.value), quote=True) ) def set_size(self, rows, cols): self.rows = rows self.cols = cols @@ -113,7 +114,7 @@ self.name = name self.value = value or "" def get_html( self, prefix="" ): - return '<input type="hidden" name="%s%s" value="%s">' % ( prefix, self.name, self.value ) + return '<input type="hidden" name="%s%s" value="%s">' % ( prefix, self.name, escape(str(self.value), quote=True) ) class SelectField(BaseField): """ @@ -190,9 +191,9 @@ if len(self.options) > 2 and ctr % 2 == 1: style = " class=\"odd_row\"" if selected: - rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s" checked>%s</div>' % ( style, prefix, self.name, value, text) ) + rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s" checked>%s</div>' % ( style, prefix, self.name, escape(str(value), quote=True), text) ) else: - rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s">%s</div>' % ( style, prefix, self.name, value, text) ) + rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s">%s</div>' % ( style, prefix, self.name, escape(str(value), quote=True), text) ) ctr += 1 return "\n".join( rval ) def get_html_radio( self, prefix="" ): @@ -204,7 +205,7 @@ style = " class=\"odd_row\"" if selected: selected_text = " checked" else: selected_text = "" - rval.append( '<div%s><input type="radio" name="%s%s"%s value="%s"%s>%s</div>' % ( style, prefix, self.name, self.refresh_on_change_text, value, selected_text, text ) ) + rval.append( '<div%s><input type="radio" name="%s%s"%s value="%s"%s>%s</div>' % ( style, prefix, self.name, self.refresh_on_change_text, escape(str(value), quote=True), selected_text, text ) ) ctr += 1 return "\n".join( rval ) def get_html_default( self, prefix="" ): @@ -217,9 +218,9 @@ selected_text = " selected" last_selected_value = value else: selected_text = "" - rval.append( '<option value="%s"%s>%s</option>' % ( value, selected_text, text ) ) + rval.append( '<option value="%s"%s>%s</option>' % ( escape(str(value), quote=True), selected_text, text ) ) if last_selected_value: - last_selected_value = ' last_selected_value="%s"' % last_selected_value + last_selected_value = ' last_selected_value="%s"' % escape(str(last_selected_value), quote=True) rval.insert( 0, '<select name="%s%s"%s%s%s>' % ( prefix, self.name, multiple, self.refresh_on_change_text, last_selected_value ) ) rval.append( '</select>' ) return "\n".join( rval ) @@ -326,12 +327,12 @@ if option['value'] in expanded_options: default_state = 'expanded' default_icon = '[-]' - html.append( '<li><span class="toolParameterExpandableCollapsable">%s</span><input type="%s" name="%s%s" value="%s"%s">%s' % ( default_icon, self.display, prefix, self.name, option['value'], selected, option['name']) ) + html.append( '<li><span class="toolParameterExpandableCollapsable">%s</span><input type="%s" name="%s%s" value="%s"%s">%s' % ( default_icon, self.display, prefix, self.name, escape(str(option['value']), quote=True), selected, option['name']) ) html.append( '<ul class="toolParameterExpandableCollapsable" default_state="%s">' % default_state ) recurse_options( html, option['options'], expanded_options ) html.append( '</ul>') else: - html.append( '<li><input type="%s" name="%s%s" value="%s"%s">%s' % ( self.display, prefix, self.name, option['value'], selected, option['name']) ) + html.append( '<li><input type="%s" name="%s%s" value="%s"%s">%s' % ( self.display, prefix, self.name, escape(str(option['value']), quote=True), selected, option['name']) ) html.append( '</li>' ) rval = [] rval.append( '<div><ul class="toolParameterExpandableCollapsable">' ) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -93,8 +93,8 @@ """ Exception to make throwing errors from deep in controllers easier """ - def __init__( self, message, type="info" ): - self.message = message + def __init__( self, err_msg, type="info" ): + self.err_msg = err_msg self.type = type def error( message ): @@ -117,7 +117,7 @@ self.security = galaxy_app.security def handle_controller_exception( self, e, trans, **kwargs ): if isinstance( e, MessageException ): - return trans.show_message( e.message, e.type ) + return trans.show_message( e.err_msg, e.type ) def make_body_iterable( self, trans, body ): if isinstance( body, FormBuilder ): body = trans.show_form( body ) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/framework/helpers/grids.py --- a/lib/galaxy/web/framework/helpers/grids.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/framework/helpers/grids.py Thu Aug 20 11:39:32 2009 -0400 @@ -156,9 +156,7 @@ elif column_filter == "All": del filter_args[self.key] return query - - - + class GridOperation( object ): def __init__( self, label, key=None, condition=None, allow_multiple=True ): self.label = label diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/webapps/reports/controllers/root.py --- a/lib/galaxy/webapps/reports/controllers/root.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/webapps/reports/controllers/root.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,8 +1,8 @@ -import sys, os, operator, sets, string, shutil, re, socket, urllib +import sys, os, operator, string, shutil, re, socket, urllib, time from galaxy import web from cgi import escape, FieldStorage from galaxy.webapps.reports.base.controller import * -import logging, sets, time +import logging log = logging.getLogger( __name__ ) class Report( BaseController ): diff -r 881dd4c2de9f -r 070cf5f6f928 static/jStore.Flash.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/jStore.Flash.html Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,19 @@ +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"> + <head> + <title>Flash External Object</title> + <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> + <script type="text/javascript"> + /** + * This function captures the flash_ready event. We need to relay this + * back to the parent so it knows flash is ready. + */ + function flash_ready(){ + parent.flash_ready(); + } + </script> + </head> + <body> + <object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#versio..." width="1" height="1" id="jStoreFlash"><param name="allowScriptAccess" value="always" /><param name="movie" value="jStore.swf" /><param name="quality" value="high" /><param name="bgcolor" value="#ffcc00" /><embed src="jStore.swf" quality="high" bgcolor="#ffcc00" width="1" height="1" name="jStoreFlash" align="middle" allowScriptAccess="always" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /></object> + </body> +</html> \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/jStore.swf Binary file static/jStore.swf has changed diff -r 881dd4c2de9f -r 070cf5f6f928 static/june_2007_style/blue/history.css --- a/static/june_2007_style/blue/history.css Thu Aug 20 10:52:08 2009 -0400 +++ b/static/june_2007_style/blue/history.css Thu Aug 20 11:39:32 2009 -0400 @@ -13,6 +13,8 @@ div.historyItem-empty .state-icon{background:url(history-states.png) no-repeat 0px -25px;} div.historyItem-running{border-color:#AAAA66;background:#FFFFCC;} div.historyItem-running .state-icon{background-image:url(data_running.gif);} +div.historyItem-setting_metadata{border-color:#AAAA66;background:#FFFFCC;} +div.historyItem-setting_metadata .state-icon{background-image:url(data_running.gif);} div.historyItem-upload{border-color:#6666AA;background:#CCCCFF;} div.historyItem-upload .state-icon{background-image:url(data_upload.gif);} div.historyItem-queued{background:#EEEEEE;} diff -r 881dd4c2de9f -r 070cf5f6f928 static/june_2007_style/history.css.tmpl --- a/static/june_2007_style/history.css.tmpl Thu Aug 20 10:52:08 2009 -0400 +++ b/static/june_2007_style/history.css.tmpl Thu Aug 20 11:39:32 2009 -0400 @@ -72,6 +72,14 @@ } div.historyItem-running { + border-color: $history_running_border; + background: $history_running_bg; + .state-icon { + background-image: url(data_running.gif); + } +} + +div.historyItem-setting_metadata { border-color: $history_running_border; background: $history_running_bg; .state-icon { diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/galaxy.workflow_editor.canvas.js --- a/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 20 10:52:08 2009 -0400 +++ b/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 20 11:39:32 2009 -0400 @@ -359,6 +359,7 @@ this.nodes = {}; this.name = null; this.has_changes = false; + this.active_form_has_changes = false; } $.extend( Workflow.prototype, { add_node : function( node ) { @@ -438,6 +439,14 @@ }); }); }, + check_changes_in_active_form : function() { + // If active form has changed, save it + if (this.active_form_has_changes) { + this.has_changes = true; + $("#right-content").find("form").submit(); + this.active_form_has_changes = false; + } + }, clear_active_node : function() { if ( this.active_node ) { this.active_node.make_inactive(); @@ -447,6 +456,7 @@ }, activate_node : function( node ) { if ( this.active_node != node ) { + this.check_changes_in_active_form(); this.clear_active_node(); parent.show_form_for_tool( node.form_html, node ); node.make_active(); @@ -461,6 +471,7 @@ } }, layout : function () { + this.check_changes_in_active_form(); // Prepare predecessor / successor tracking var n_pred = {}; var successors = {}; @@ -502,7 +513,7 @@ var v = level_parents[k]; delete n_pred[v]; for ( var sk in successors[v] ) { - n_pred[ sucessors[v][sk] ] -= 1; + n_pred[ successors[v][sk] ] -= 1; } } } @@ -805,6 +816,10 @@ self.draw_overview(); }); + /* Disable dragging for child element of the panel so that resizing can + only be done by dragging the borders */ + $("#overview-border div").bind("drag", function(e) { }); + }, update_viewport_overlay: function() { var cc = this.cc, diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/jquery.jstore-all.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/jquery.jstore-all.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,748 @@ +/*! + * jStore - Persistent Client-Side Storage + * + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * + * Dual licensed under: + * MIT: http://www.opensource.org/licenses/mit-license.php + * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html + *//** + * Javascript Class Framework + * + * Copyright (c) 2008 John Resig (http://ejohn.org/blog/simple-javascript-inheritance/) + * Inspired by base2 and Prototype + */ +(function(){ + var initializing = false, fnTest = /xyz/.test(function(){xyz;}) ? /\b_super\b/ : /.*/; + + // The base Class implementation (does nothing) + this.Class = function(){}; + + // Create a new Class that inherits from this class + Class.extend = function(prop) { + var _super = this.prototype; + + // Instantiate a base class (but only create the instance, + // don't run the init constructor) + initializing = true; + var prototype = new this(); + initializing = false; + + // Copy the properties over onto the new prototype + for (var name in prop) { + // Check if we're overwriting an existing function + prototype[name] = typeof prop[name] == "function" && + typeof _super[name] == "function" && fnTest.test(prop[name]) ? + (function(name, fn){ + return function() { + var tmp = this._super; + + // Add a new ._super() method that is the same method + // but on the super-class + this._super = _super[name]; + + // The method only need to be bound temporarily, so we + // remove it when we're done executing + var ret = fn.apply(this, arguments); + this._super = tmp; + + return ret; + }; + })(name, prop[name]) : + prop[name]; + } + + // The dummy class constructor + function Class() { + // All construction is actually done in the init method + if ( !initializing && this.init ) + this.init.apply(this, arguments); + } + + // Populate our constructed prototype object + Class.prototype = prototype; + + // Enforce the constructor to be what we expect + Class.constructor = Class; + + // And make this class extendable + Class.extend = arguments.callee; + + return Class; + }; +})(); +/*! + * jStore Delegate Framework + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + this.jStoreDelegate = Class.extend({ + init: function(parent){ + // The Object this delgate operates for + this.parent = parent; + // Container for callbacks to dispatch. + // eventType => [ callback, callback, ... ] + this.callbacks = {}; + }, + bind: function(event, callback){ + if ( !$.isFunction(callback) ) return this; + if ( !this.callbacks[ event ] ) this.callbacks[ event ] = []; + + this.callbacks[ event ].push(callback); + + return this; + }, + trigger: function(){ + var parent = this.parent, + args = [].slice.call(arguments), + event = args.shift(), + handlers = this.callbacks[ event ]; + + if ( !handlers ) return false; + + $.each(handlers, function(){ this.apply(parent, args) }); + return this; + } + }); + +})(jQuery);/** + * jStore-jQuery Interface + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Setup the jStore namespace in jQuery for options storage + $.jStore = {}; + + // Seed the options in + $.extend($.jStore, { + EngineOrder: [], + // Engines should put their availability tests within jStore.Availability + Availability: {}, + // Defined engines should enter themselves into the jStore.Engines + Engines: {}, + // Instanciated engines should exist within jStore.Instances + Instances: {}, + // The current engine to use for storage + CurrentEngine: null, + // Provide global settings for overwriting + defaults: { + project: null, + engine: null, + autoload: true, + flash: 'jStore.Flash.html' + }, + // Boolean for ready state handling + isReady: false, + // Boolean for flash ready state handling + isFlashReady: false, + // An event delegate + delegate: new jStoreDelegate($.jStore) + .bind('jStore-ready', function(engine){ + $.jStore.isReady = true; + if ($.jStore.defaults.autoload) engine.connect(); + }) + .bind('flash-ready', function(){ + $.jStore.isFlashReady = true; + }) + }); + + // Enable ready callback for jStore + $.jStore.ready = function(callback){ + if ($.jStore.isReady) callback.apply($.jStore, [$.jStore.CurrentEngine]); + else $.jStore.delegate.bind('jStore-ready', callback); + } + + // Enable failure callback registration for jStore + $.jStore.fail = function(callback){ + $.jStore.delegate.bind('jStore-failure', callback); + } + + // Enable ready callback for Flash + $.jStore.flashReady = function(callback){ + if ($.jStore.isFlashReady) callback.apply($.jStore, [$.jStore.CurrentEngine]); + else $.jStore.delegate.bind('flash-ready', callback); + } + + // Enable and test an engine + $.jStore.use = function(engine, project, identifier){ + project = project || $.jStore.defaults.project || location.hostname.replace(/\./g, '-') || 'unknown'; + + var e = $.jStore.Engines[engine.toLowerCase()] || null, + name = (identifier ? identifier + '.' : '') + project + '.' + engine; + + if ( !e ) throw 'JSTORE_ENGINE_UNDEFINED'; + + // Instanciate the engine + e = new e(project, name); + + // Prevent against naming conflicts + if ($.jStore.Instances[name]) throw 'JSTORE_JRI_CONFLICT'; + + // Test the engine + if (e.isAvailable()){ + $.jStore.Instances[name] = e; // The Easy Way + if (!$.jStore.CurrentEngine){ + $.jStore.CurrentEngine = e; + } + $.jStore.delegate.trigger('jStore-ready', e); + } else { + if (!e.autoload) // Not available + throw 'JSTORE_ENGINE_UNAVILABLE'; + else { // The hard way + e.included(function(){ + if (this.isAvailable()) { // Worked out + $.jStore.Instances[name] = this; + // If there is no current engine, use this one + if (!$.jStore.CurrentEngine){ + $.jStore.CurrentEngine = this; + } + $.jStore.delegate.trigger('jStore-ready', this); + } + else $.jStore.delegate.trigger('jStore-failure', this); + }).include(); + } + } + } + + // Set the current storage engine + $.jStore.setCurrentEngine = function(name){ + if (!$.jStore.Instances.length ) // If no instances exist, attempt to load one + return $.jStore.FindEngine(); + + if (!name && $.jStore.Instances.length >= 1) { // If no name is specified, use the first engine + $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[0]); + return $.jStore.CurrentEngine = $.jStore.Instances[0]; + } + + if (name && $.jStore.Instances[name]) { // If a name is specified and exists, use it + $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[name]); + return $.jStore.CurrentEngine = $.jStore.Instances[name]; + } + + throw 'JSTORE_JRI_NO_MATCH'; + } + + // Test all possible engines for straightforward useability + $.jStore.FindEngine = function(){ + $.each($.jStore.EngineOrder, function(k){ + if ($.jStore.Availability[this]()){ // Find the first, easiest option and use it. + $.jStore.use(this, $.jStore.defaults.project, 'default'); + return false; + } + }) + } + + // Provide a simple interface for storing/getting values + $.jStore.store = function(key, value){ + if (!$.jStore.CurrentEngine) return false; + + if ( !value ) // Executing a get command + return $.jStore.CurrentEngine.get(key); + // Executing a set command + return $.jStore.CurrentEngine.set(key, value); + } + // Provide a simple interface for storing/getting values + $.jStore.remove = function(key){ + if (!$.jStore.CurrentEngine) return false; + + return $.jStore.CurrentEngine.rem(key); + } + + // Provide a chainable interface for storing values/getting a value at the end of a chain + $.fn.store = function(key, value){ + if (!$.jStore.CurrentEngine) return this; + + var result = $.jStore.store(key, value); + + return !value ? result : this; + } + + // Provide a chainable interface for removing values + $.fn.removeStore = function(key){ + $.jStore.remove(key); + + return this; + } + + // Provide a way for users to call for auto-loading + $.jStore.load = function(){ + if ($.jStore.defaults.engine) + return $.jStore.use($.jStore.defaults.engine, $.jStore.defaults.project, 'default'); + + // Attempt to find a valid engine, and catch any exceptions if we can't + try { + $.jStore.FindEngine(); + } catch (e) {} + } + +})(jQuery); +/** + * jStore Engine Core + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + this.StorageEngine = Class.extend({ + init: function(project, name){ + // Configure the project name + this.project = project; + // The JRI name given by the manager + this.jri = name; + // Cache the data so we can work synchronously + this.data = {}; + // The maximum limit of the storage engine + this.limit = -1; + // Third party script includes + this.includes = []; + // Create an event delegate for users to subscribe to event triggers + this.delegate = new jStoreDelegate(this) + .bind('engine-ready', function(){ + this.isReady = true; + }) + .bind('engine-included', function(){ + this.hasIncluded = true; + }); + // If enabled, the manager will check availability, then run include(), then check again + this.autoload = false; // This should be changed by the engines, if they have required includes + // When set, we're ready to transact data + this.isReady = false; + // When the includer is finished, it will set this to true + this.hasIncluded = false; + }, + // Performs all necessary script includes + include: function(){ + var self = this, + total = this.includes.length, + count = 0; + + $.each(this.includes, function(){ + $.ajax({type: 'get', url: this, dataType: 'script', cache: true, + success: function(){ + count++; + if (count == total) self.delegate.trigger('engine-included'); + } + }) + }); + }, + // This should be overloaded with an actual functionality presence check + isAvailable: function(){ + return false; + }, + /** Event Subscription Shortcuts **/ + ready: function(callback){ + if (this.isReady) callback.apply(this); + else this.delegate.bind('engine-ready', callback); + return this; + }, + included: function(callback){ + if (this.hasIncluded) callback.apply(this); + else this.delegate.bind('engine-included', callback); + return this; + }, + /** Cache Data Access **/ + get: function(key){ + return this.data[key] || null; + }, + set: function(key, value){ + this.data[key] = value; + return value; + }, + rem: function(key){ + var beforeDelete = this.data[key]; + this.data[key] = null; + return beforeDelete; + } + }); + +})(jQuery); +/*! + * jStore DOM Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var sessionAvailability = $.jStore.Availability.session = function(){ + return !!window.sessionStorage; + }, + localAvailability = $.jStore.Availability.local = function(){ + return !!(window.localStorage || window.globalStorage); + }; + + this.jStoreDom = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'DOM'; + + // Set the Database limit + this.limit = 5 * 1024 * 1024; + }, + connect: function(){ + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + get: function(key){ + var out = this.db.getItem(key); + // Gecko's getItem returns {value: 'the value'}, WebKit returns 'the value' + return out && out.value ? out.value : out + }, + set: function(key, value){ + this.db.setItem(key,value); + return value; + }, + rem: function(key){ + var out = this.get(key); + this.db.removeItem(key); + return out + } + }) + + this.jStoreLocal = jStoreDom.extend({ + connect: function(){ + // Gecko uses a non-standard globalStorage[ www.example.com ] DOM access object for persistant storage. + this.db = !window.globalStorage ? window.localStorage : window.globalStorage[location.hostname]; + this._super(); + }, + isAvailable: localAvailability + }) + + this.jStoreSession = jStoreDom.extend({ + connect: function(){ + this.db = sessionStorage; + this._super(); + }, + isAvailable: sessionAvailability + }) + + $.jStore.Engines.local = jStoreLocal; + $.jStore.Engines.session = jStoreSession; + + // Store the ordering preference + $.jStore.EngineOrder[ 1 ] = 'local'; + +})(jQuery); +/*! + * jStore Flash Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.flash = function(){ + return !!($.jStore.hasFlash('8.0.0')); + } + + this.jStoreFlash = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'Flash'; + + // Bind our flashReady function to the jStore Delegate + var self = this; + $.jStore.flashReady(function(){ self.flashReady() }); + }, + connect: function(){ + var name = 'jstore-flash-embed-' + this.project; + + // To make Flash Storage work on IE, we have to load up an iFrame + // which contains an HTML page that embeds the object using an + // object tag wrapping an embed tag. Of course, this is unnecessary for + // all browsers except for IE, which, to my knowledge, is the only browser + // in existance where you need to complicate your code to fix bugs. Goddamnit. :( + $(document.body) + .append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" ' + + 'id="jStoreFlashFrame" src="' +$.jStore.defaults.flash + '"></iframe>'); + }, + flashReady: function(e){ + var iFrame = $('#jStoreFlashFrame')[0]; + + // IE + if (iFrame.Document && $.isFunction(iFrame.Document['jStoreFlash'].f_get_cookie)) this.db = iFrame.Document['jStoreFlash']; + // Safari && Firefox + else if (iFrame.contentWindow && iFrame.contentWindow.document){ + var doc = iFrame.contentWindow.document; + // Safari + if ($.isFunction($('object', $(doc))[0].f_get_cookie)) this.db = $('object', $(doc))[0]; + // Firefox + else if ($.isFunction($('embed', $(doc))[0].f_get_cookie)) this.db = $('embed', $(doc))[0]; + } + + // We're ready to process data + if (this.db) this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + get: function(key){ + var out = this.db.f_get_cookie(key); + return out == 'null' ? null : out; + }, + set: function(key, value){ + this.db.f_set_cookie(key, value); + return value; + }, + rem: function(key){ + var beforeDelete = this.get(key); + this.db.f_delete_cookie(key); + return beforeDelete; + } + }) + + $.jStore.Engines.flash = jStoreFlash; + + // Store the ordering preference + $.jStore.EngineOrder[ 2 ] = 'flash'; + + /** + * Flash Detection functions copied from the jQuery Flash Plugin + * Copyright (c) 2006 Luke Lutman (http://jquery.lukelutman.com/plugins/flash) + * Dual licensed under the MIT and GPL licenses. + * http://www.opensource.org/licenses/mit-license.php + * http://www.opensource.org/licenses/gpl-license.php + */ + $.jStore.hasFlash = function(version){ + var pv = $.jStore.flashVersion().match(/\d+/g), + rv = version.match(/\d+/g); + + for(var i = 0; i < 3; i++) { + pv[i] = parseInt(pv[i] || 0); + rv[i] = parseInt(rv[i] || 0); + // player is less than required + if(pv[i] < rv[i]) return false; + // player is greater than required + if(pv[i] > rv[i]) return true; + } + // major version, minor version and revision match exactly + return true; + } + + $.jStore.flashVersion = function(){ + // ie + try { + try { + // avoid fp6 minor version lookup issues + // see: http://blog.deconcept.com/2006/01/11/getvariable-setvariable-crash-internet-... + var axo = new ActiveXObject('ShockwaveFlash.ShockwaveFlash.6'); + try { axo.AllowScriptAccess = 'always'; } + catch(e) { return '6,0,0'; } + } catch(e) {} + return new ActiveXObject('ShockwaveFlash.ShockwaveFlash').GetVariable('$version').replace(/\D+/g, ',').match(/^,?(.+),?$/)[1]; + // other browsers + } catch(e) { + try { + if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){ + return (navigator.plugins["Shockwave Flash 2.0"] || navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g, ",").match(/^,?(.+),?$/)[1]; + } + } catch(e) {} + } + return '0,0,0'; + } + +})(jQuery); + +// Callback fired when ExternalInterface is established +function flash_ready(){ + $.jStore.delegate.trigger('flash-ready'); +} +/*! + * jStore Google Gears Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.gears = function(){ + return !!(window.google && window.google.gears) + } + + this.jStoreGears = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'Google Gears'; + + // Add required third-party scripts + this.includes.push('http://code.google.com/apis/gears/gears_init.js'); + + // Allow Autoloading on fail + this.autoload = true; + }, + connect: function(){ + // Create our database connection + var db = this.db = google.gears.factory.create('beta.database'); + db.open( 'jstore-' + this.project ); + db.execute( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' ); + + // Cache the data from the table + this.updateCache(); + }, + updateCache: function(){ + // Read the database into our cache object + var result = this.db.execute( 'SELECT k,v FROM jstore' ); + while (result.isValidRow()){ + this.data[result.field(0)] = result.field(1); + result.next(); + } result.close(); + + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + set: function(key, value){ + // Update the database + var db = this.db; + db.execute( 'BEGIN' ); + db.execute( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value] ); + db.execute( 'COMMIT' ); + return this._super(key, value); + }, + rem: function(key){ + // Update the database + var db = this.db; + db.execute( 'BEGIN' ); + db.execute( 'DELETE FROM jstore WHERE k = ?', [key] ); + db.execute( 'COMMIT' ); + return this._super(key); + } + }) + + $.jStore.Engines.gears = jStoreGears; + + // Store the ordering preference + $.jStore.EngineOrder[ 3 ] = 'gears'; + +})(jQuery); +/*! + * jStore HTML5 Specification Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.html5 = function(){ + return !!window.openDatabase + } + + this.jStoreHtml5 = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'HTML5'; + + // Set the Database limit + this.limit = 1024 * 200; + }, + connect: function(){ + // Create our database connection + var db = this.db = openDatabase('jstore-' + this.project, '1.0', this.project, this.limit); + if (!db) throw 'JSTORE_ENGINE_HTML5_NODB'; + db.transaction(function(db){ + db.executeSql( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' ); + }); + + // Cache the data from the table + this.updateCache(); + }, + updateCache: function(){ + var self = this; + // Read the database into our cache object + this.db.transaction(function(db){ + db.executeSql( 'SELECT k,v FROM jstore', [], function(db, result){ + var rows = result.rows, i = 0, row; + for (; i < rows.length; ++i){ + row = rows.item(i); + self.data[row.k] = row.v; + } + + // Fire our delegate to indicate we're ready for data transactions + self.delegate.trigger('engine-ready'); + }); + }); + }, + isAvailable: avilability, + set: function(key, value){ + // Update the database + this.db.transaction(function(db){ + db.executeSql( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value]); + }); + return this._super(key, value); + }, + rem: function(key){ + // Update the database + this.db.transaction(function(db){ + db.executeSql( 'DELETE FROM jstore WHERE k = ?', [key] ) + }) + return this._super(key); + } + }) + + $.jStore.Engines.html5 = jStoreHtml5; + + // Store the ordering preference + $.jStore.EngineOrder[ 0 ] = 'html5'; + +})(jQuery); +/*!* + * jStore IE Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.ie = function(){ + return !!window.ActiveXObject; + } + + this.jStoreIE = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'IE'; + + // Allow Autoloading on fail + this.limit = 64 * 1024; + }, + connect: function(){ + // Create a hidden div to store attributes in + this.db = $('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-' + this.project + '"></div>') + .appendTo(document.body).get(0); + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + get: function(key){ + this.db.load(this.project); + return this.db.getAttribute(key); + }, + set: function(key, value){ + this.db.setAttribute(key, value); + this.db.save(this.project); + return value; + }, + rem: function(key){ + var beforeDelete = this.get(key); + this.db.removeAttribute(key); + this.db.save(this.project); + return beforeDelete; + } + }) + + $.jStore.Engines.ie = jStoreIE; + + // Store the ordering preference + $.jStore.EngineOrder[ 4 ] = 'ie'; + +})(jQuery); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/json2.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/json2.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,476 @@ +/* + http://www.JSON.org/json2.js + 2009-06-29 + + Public Domain. + + NO WARRANTY EXPRESSED OR IMPLIED. USE AT YOUR OWN RISK. + + See http://www.JSON.org/js.html + + This file creates a global JSON object containing two methods: stringify + and parse. + + JSON.stringify(value, replacer, space) + value any JavaScript value, usually an object or array. + + replacer an optional parameter that determines how object + values are stringified for objects. It can be a + function or an array of strings. + + space an optional parameter that specifies the indentation + of nested structures. If it is omitted, the text will + be packed without extra whitespace. If it is a number, + it will specify the number of spaces to indent at each + level. If it is a string (such as '\t' or ' '), + it contains the characters used to indent at each level. + + This method produces a JSON text from a JavaScript value. + + When an object value is found, if the object contains a toJSON + method, its toJSON method will be called and the result will be + stringified. A toJSON method does not serialize: it returns the + value represented by the name/value pair that should be serialized, + or undefined if nothing should be serialized. The toJSON method + will be passed the key associated with the value, and this will be + bound to the object holding the key. + + For example, this would serialize Dates as ISO strings. + + Date.prototype.toJSON = function (key) { + function f(n) { + // Format integers to have at least two digits. + return n < 10 ? '0' + n : n; + } + + return this.getUTCFullYear() + '-' + + f(this.getUTCMonth() + 1) + '-' + + f(this.getUTCDate()) + 'T' + + f(this.getUTCHours()) + ':' + + f(this.getUTCMinutes()) + ':' + + f(this.getUTCSeconds()) + 'Z'; + }; + + You can provide an optional replacer method. It will be passed the + key and value of each member, with this bound to the containing + object. The value that is returned from your method will be + serialized. If your method returns undefined, then the member will + be excluded from the serialization. + + If the replacer parameter is an array of strings, then it will be + used to select the members to be serialized. It filters the results + such that only members with keys listed in the replacer array are + stringified. + + Values that do not have JSON representations, such as undefined or + functions, will not be serialized. Such values in objects will be + dropped; in arrays they will be replaced with null. You can use + a replacer function to replace those with JSON values. + JSON.stringify(undefined) returns undefined. + + The optional space parameter produces a stringification of the + value that is filled with line breaks and indentation to make it + easier to read. + + If the space parameter is a non-empty string, then that string will + be used for indentation. If the space parameter is a number, then + the indentation will be that many spaces. + + Example: + + text = JSON.stringify(['e', {pluribus: 'unum'}]); + // text is '["e",{"pluribus":"unum"}]' + + + text = JSON.stringify(['e', {pluribus: 'unum'}], null, '\t'); + // text is '[\n\t"e",\n\t{\n\t\t"pluribus": "unum"\n\t}\n]' + + text = JSON.stringify([new Date()], function (key, value) { + return this[key] instanceof Date ? + 'Date(' + this[key] + ')' : value; + }); + // text is '["Date(---current time---)"]' + + + JSON.parse(text, reviver) + This method parses a JSON text to produce an object or array. + It can throw a SyntaxError exception. + + The optional reviver parameter is a function that can filter and + transform the results. It receives each of the keys and values, + and its return value is used instead of the original value. + If it returns what it received, then the structure is not modified. + If it returns undefined then the member is deleted. + + Example: + + // Parse the text. Values that look like ISO date strings will + // be converted to Date objects. + + myData = JSON.parse(text, function (key, value) { + var a; + if (typeof value === 'string') { + a = +/^(\d{4})-(\d{2})-(\d{2})T(\d{2}):(\d{2}):(\d{2}(?:\.\d*)?)Z$/.exec(value); + if (a) { + return new Date(Date.UTC(+a[1], +a[2] - 1, +a[3], +a[4], + +a[5], +a[6])); + } + } + return value; + }); + + myData = JSON.parse('["Date(09/09/2001)"]', function (key, value) { + var d; + if (typeof value === 'string' && + value.slice(0, 5) === 'Date(' && + value.slice(-1) === ')') { + d = new Date(value.slice(5, -1)); + if (d) { + return d; + } + } + return value; + }); + + + This is a reference implementation. You are free to copy, modify, or + redistribute. + + This code should be minified before deployment. + See http://javascript.crockford.com/jsmin.html + + USE YOUR OWN COPY. IT IS EXTREMELY UNWISE TO LOAD CODE FROM SERVERS YOU DO + NOT CONTROL. +*/ + +/*jslint evil: true */ + +/*members "", "\b", "\t", "\n", "\f", "\r", "\"", JSON, "\\", apply, + call, charCodeAt, getUTCDate, getUTCFullYear, getUTCHours, + getUTCMinutes, getUTCMonth, getUTCSeconds, hasOwnProperty, join, + lastIndex, length, parse, prototype, push, replace, slice, stringify, + test, toJSON, toString, valueOf +*/ + +// Create a JSON object only if one does not already exist. We create the +// methods in a closure to avoid creating global variables. + +var JSON = JSON || {}; + +(function () { + + function f(n) { + // Format integers to have at least two digits. + return n < 10 ? '0' + n : n; + } + + if (typeof Date.prototype.toJSON !== 'function') { + + Date.prototype.toJSON = function (key) { + + return isFinite(this.valueOf()) ? + this.getUTCFullYear() + '-' + + f(this.getUTCMonth() + 1) + '-' + + f(this.getUTCDate()) + 'T' + + f(this.getUTCHours()) + ':' + + f(this.getUTCMinutes()) + ':' + + f(this.getUTCSeconds()) + 'Z' : null; + }; + + String.prototype.toJSON = + Number.prototype.toJSON = + Boolean.prototype.toJSON = function (key) { + return this.valueOf(); + }; + } + + var cx = /[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g, + escapable = /[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g, + gap, + indent, + meta = { // table of character substitutions + '\b': '\\b', + '\t': '\\t', + '\n': '\\n', + '\f': '\\f', + '\r': '\\r', + '"' : '\\"', + '\\': '\\\\' + }, + rep; + + + function quote(string) { + +// If the string contains no control characters, no quote characters, and no +// backslash characters, then we can safely slap some quotes around it. +// Otherwise we must also replace the offending characters with safe escape +// sequences. + + escapable.lastIndex = 0; + return escapable.test(string) ? + '"' + string.replace(escapable, function (a) { + var c = meta[a]; + return typeof c === 'string' ? c : + '\\u' + ('0000' + a.charCodeAt(0).toString(16)).slice(-4); + }) + '"' : + '"' + string + '"'; + } + + + function str(key, holder) { + +// Produce a string from holder[key]. + + var i, // The loop counter. + k, // The member key. + v, // The member value. + length, + mind = gap, + partial, + value = holder[key]; + +// If the value has a toJSON method, call it to obtain a replacement value. + + if (value && typeof value === 'object' && + typeof value.toJSON === 'function') { + value = value.toJSON(key); + } + +// If we were called with a replacer function, then call the replacer to +// obtain a replacement value. + + if (typeof rep === 'function') { + value = rep.call(holder, key, value); + } + +// What happens next depends on the value's type. + + switch (typeof value) { + case 'string': + return quote(value); + + case 'number': + +// JSON numbers must be finite. Encode non-finite numbers as null. + + return isFinite(value) ? String(value) : 'null'; + + case 'boolean': + case 'null': + +// If the value is a boolean or null, convert it to a string. Note: +// typeof null does not produce 'null'. The case is included here in +// the remote chance that this gets fixed someday. + + return String(value); + +// If the type is 'object', we might be dealing with an object or an array or +// null. + + case 'object': + +// Due to a specification blunder in ECMAScript, typeof null is 'object', +// so watch out for that case. + + if (!value) { + return 'null'; + } + +// Make an array to hold the partial results of stringifying this object value. + + gap += indent; + partial = []; + +// Is the value an array? + + if (Object.prototype.toString.apply(value) === '[object Array]') { + +// The value is an array. Stringify every element. Use null as a placeholder +// for non-JSON values. + + length = value.length; + for (i = 0; i < length; i += 1) { + partial[i] = str(i, value) || 'null'; + } + +// Join all of the elements together, separated with commas, and wrap them in +// brackets. + + v = partial.length === 0 ? '[]' : + gap ? '[\n' + gap + + partial.join(',\n' + gap) + '\n' + + mind + ']' : + '[' + partial.join(',') + ']'; + gap = mind; + return v; + } + +// If the replacer is an array, use it to select the members to be stringified. + + if (rep && typeof rep === 'object') { + length = rep.length; + for (i = 0; i < length; i += 1) { + k = rep[i]; + if (typeof k === 'string') { + v = str(k, value); + if (v) { + partial.push(quote(k) + (gap ? ': ' : ':') + v); + } + } + } + } else { + +// Otherwise, iterate through all of the keys in the object. + + for (k in value) { + if (Object.hasOwnProperty.call(value, k)) { + v = str(k, value); + if (v) { + partial.push(quote(k) + (gap ? ': ' : ':') + v); + } + } + } + } + +// Join all of the member texts together, separated with commas, +// and wrap them in braces. + + v = partial.length === 0 ? '{}' : + gap ? '{\n' + gap + partial.join(',\n' + gap) + '\n' + + mind + '}' : '{' + partial.join(',') + '}'; + gap = mind; + return v; + } + } + +// If the JSON object does not yet have a stringify method, give it one. + + if (typeof JSON.stringify !== 'function') { + JSON.stringify = function (value, replacer, space) { + +// The stringify method takes a value and an optional replacer, and an optional +// space parameter, and returns a JSON text. The replacer can be a function +// that can replace values, or an array of strings that will select the keys. +// A default replacer method can be provided. Use of the space parameter can +// produce text that is more easily readable. + + var i; + gap = ''; + indent = ''; + +// If the space parameter is a number, make an indent string containing that +// many spaces. + + if (typeof space === 'number') { + for (i = 0; i < space; i += 1) { + indent += ' '; + } + +// If the space parameter is a string, it will be used as the indent string. + + } else if (typeof space === 'string') { + indent = space; + } + +// If there is a replacer, it must be a function or an array. +// Otherwise, throw an error. + + rep = replacer; + if (replacer && typeof replacer !== 'function' && + (typeof replacer !== 'object' || + typeof replacer.length !== 'number')) { + throw new Error('JSON.stringify'); + } + +// Make a fake root object containing our value under the key of ''. +// Return the result of stringifying the value. + + return str('', {'': value}); + }; + } + + +// If the JSON object does not yet have a parse method, give it one. + + if (typeof JSON.parse !== 'function') { + JSON.parse = function (text, reviver) { + +// The parse method takes a text and an optional reviver function, and returns +// a JavaScript value if the text is a valid JSON text. + + var j; + + function walk(holder, key) { + +// The walk method is used to recursively walk the resulting structure so +// that modifications can be made. + + var k, v, value = holder[key]; + if (value && typeof value === 'object') { + for (k in value) { + if (Object.hasOwnProperty.call(value, k)) { + v = walk(value, k); + if (v !== undefined) { + value[k] = v; + } else { + delete value[k]; + } + } + } + } + return reviver.call(holder, key, value); + } + + +// Parsing happens in four stages. In the first stage, we replace certain +// Unicode characters with escape sequences. JavaScript handles many characters +// incorrectly, either silently deleting them, or treating them as line endings. + + cx.lastIndex = 0; + if (cx.test(text)) { + text = text.replace(cx, function (a) { + return '\\u' + + ('0000' + a.charCodeAt(0).toString(16)).slice(-4); + }); + } + +// In the second stage, we run the text against regular expressions that look +// for non-JSON patterns. We are especially concerned with '()' and 'new' +// because they can cause invocation, and '=' because it can cause mutation. +// But just to be safe, we want to reject all unexpected forms. + +// We split the second stage into 4 regexp operations in order to work around +// crippling inefficiencies in IE's and Safari's regexp engines. First we +// replace the JSON backslash pairs with '@' (a non-JSON character). Second, we +// replace all simple value tokens with ']' characters. Third, we delete all +// open brackets that follow a colon or comma or that begin the text. Finally, +// we look to see that the remaining characters are only whitespace or ']' or +// ',' or ':' or '{' or '}'. If that is so, then the text is safe for eval. + + if (/^[\],:{}\s]*$/. +test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g, '@'). +replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g, ']'). +replace(/(?:^|:|,)(?:\s*\[)+/g, ''))) { + +// In the third stage we use the eval function to compile the text into a +// JavaScript structure. The '{' operator is subject to a syntactic ambiguity +// in JavaScript: it can begin a block or an object literal. We wrap the text +// in parens to eliminate the ambiguity. + + j = eval('(' + text + ')'); + +// In the optional fourth stage, we recursively walk the new structure, passing +// each name/value pair to a reviver function for possible transformation. + + return typeof reviver === 'function' ? + walk({'': j}, '') : j; + } + +// If the text is not JSON parseable, then a SyntaxError is thrown. + + throw new SyntaxError('JSON.parse'); + }; + } +}()); diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/json_cookie.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/json_cookie.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,61 @@ +/* + JSONCookie: Uses JSON to allow the settings of multiple preferences in one cookie. + Kanwei Li, 2009 + + cookie = new JSONCookie("cookie_name"); // Pass in the name of the cookie + + // Gets the value of a preference, returns optional second argument if pref not found + cookie.get("pref", "val_if_not_found"); + + cookie.set("pref", "val"); // Sets a value for the preference and saves cookie + cookie.unset("pref"); // Unsets the preference and saves cookie + cookie.clear() // Deletes the cookie + +*/ + +function JSONCookie(name) { + this.cookie_name = name; + +} + +JSONCookie.prototype = { + json_data : function() { + cookie = $.cookie(this.cookie_name); + return cookie ? JSON.parse(cookie) : null; + }, + + save : function(data) { + $.cookie(this.cookie_name, JSON.stringify(data)); + }, + + get : function(attr, else_val) { + data = this.json_data(); + if (data && data[attr]) { return data[attr]; + } else if (else_val) { return else_val; + } else { return null; + } + }, + + set : function(attr, val) { + data = this.json_data(); + if (data) { + data[attr] = val; + } else { + data = { attr : val } + } + this.save(data); + }, + + unset : function(attr) { + data = this.json_data(); + if (data) { + delete data[attr]; + } + this.save(data); + }, + + clear : function() { + this.save(null); + } + +}; \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/packed/galaxy.workflow_editor.canvas.js --- a/static/scripts/packed/galaxy.workflow_editor.canvas.js Thu Aug 20 10:52:08 2009 -0400 +++ b/static/scripts/packed/galaxy.workflow_editor.canvas.js Thu Aug 20 11:39:32 2009 -0400 @@ -1,1 +1,1 @@ -function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a) {this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*f; this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canvas.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hov er",function(){if(f.connectors.length>0){var g=$("<div class='callout'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");ret urn i}).bind("drag",function(i){var h=function(){var k=$(i.dragProxy).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dragProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b .appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extensio n+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j))});workflow.node_changed(this)},update_field_data:function(f){var c=$(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destr oy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connectors,function(j,k){f[h.name]={id:k.ha ndle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.element).position()};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.clear_active_node();parent.show_ form_for_tool(a.form_html,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html,a)}},layout:function(){var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){level_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[sucessors[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(function(p,o){return $(d[p].element).position().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this.canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$( this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></div>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this).offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prot otype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.css("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this; var a=function(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({wi dth:f,height:f});b.draw_overview()})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewp ort_overlay()}}); \ No newline at end of file +function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a) {this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*f; this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canvas.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hov er",function(){if(f.connectors.length>0){var g=$("<div class='callout'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");ret urn i}).bind("drag",function(i){var h=function(){var k=$(i.dragProxy).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dragProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b .appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extensio n+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j))});workflow.node_changed(this)},update_field_data:function(f){var c=$(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destr oy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false;this.active_form_has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connecto rs,function(j,k){f[h.name]={id:k.handle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.element).position()};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},enable_auto_save:function(){outer_this=this;$(".toolFormBody").find("input,textarea,select").each(function(){$(this).focus(function(){outer_this.active_form_has_changes=true})})},check_changes_in_active_form:functio n(){if(this.active_form_has_changes){this.has_changes=true;$(".toolFormBody").find("form").each(function(){$(this).submit()});this.active_form_has_changes=false}},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.check_changes_in_active_form();this.clear_active_node();parent.show_form_for_tool(a.form_html,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html,a)}},layout:function(){this.check_changes_in_active_form();var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){l evel_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[b[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(function(p,o){return $(d[p].element).position().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this .canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$(this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></d iv>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this). offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prototype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.c ss("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this;var a=function(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_n odes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({width:f,height:f});b.draw_overview()});$("#overview-border div").bind("drag",function(f){})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewport_overlay()}}); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/packed/jquery.jstore-all.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/packed/jquery.jstore-all.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,41 @@ +/* + * jStore - Persistent Client-Side Storage + * + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * + * Dual licensed under: + * MIT: http://www.opensource.org/licenses/mit-license.php + * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html + */ +(function(){var a=false,b=/xyz/.test(function(){xyz})?/\b_super\b/:/.*/;this.Class=function(){};Class.extend=function(g){var f=this.prototype;a=true;var e=new this();a=false;for(var d in g){e[d]=typeof g[d]=="function"&&typeof f[d]=="function"&&b.test(g[d])?(function(h,i){return function(){var k=this._super;this._super=f[h];var j=i.apply(this,arguments);this._super=k;return j}})(d,g[d]):g[d]}function c(){if(!a&&this.init){this.init.apply(this,arguments)}}c.prototype=e;c.constructor=c;c.extend=arguments.callee;return c}})(); +/* + * jStore Delegate Framework + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(a){this.jStoreDelegate=Class.extend({init:function(b){this.parent=b;this.callbacks={}},bind:function(b,c){if(!a.isFunction(c)){return this}if(!this.callbacks[b]){this.callbacks[b]=[]}this.callbacks[b].push(c);return this},trigger:function(){var d=this.parent,c=[].slice.call(arguments),e=c.shift(),b=this.callbacks[e];if(!b){return false}a.each(b,function(){this.apply(d,c)});return this}})})(jQuery);(function(a){a.jStore={};a.extend(a.jStore,{EngineOrder:[],Availability:{},Engines:{},Instances:{},CurrentEngine:null,defaults:{project:null,engine:null,autoload:true,flash:"jStore.Flash.html"},isReady:false,isFlashReady:false,delegate:new jStoreDelegate(a.jStore).bind("jStore-ready",function(b){a.jStore.isReady=true;if(a.jStore.defaults.autoload){b.connect()}}).bind("flash-ready",function(){a.jStore.isFlashReady=true})});a.jStore.ready=function(b){if(a.jStore.isReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("jStore-ready",b)}};a.jStore.fail =function(b){a.jStore.delegate.bind("jStore-failure",b)};a.jStore.flashReady=function(b){if(a.jStore.isFlashReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("flash-ready",b)}};a.jStore.use=function(d,g,c){g=g||a.jStore.defaults.project||location.hostname.replace(/\./g,"-")||"unknown";var f=a.jStore.Engines[d.toLowerCase()]||null,b=(c?c+".":"")+g+"."+d;if(!f){throw"JSTORE_ENGINE_UNDEFINED"}f=new f(g,b);if(a.jStore.Instances[b]){throw"JSTORE_JRI_CONFLICT"}if(f.isAvailable()){a.jStore.Instances[b]=f;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=f}a.jStore.delegate.trigger("jStore-ready",f)}else{if(!f.autoload){throw"JSTORE_ENGINE_UNAVILABLE"}else{f.included(function(){if(this.isAvailable()){a.jStore.Instances[b]=this;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=this}a.jStore.delegate.trigger("jStore-ready",this)}else{a.jStore.delegate.trigger("jStore-failure",this)}}).include()}}};a.jStore.setCurrentEngine=function(b){if(!a.jStore.Instanc es.length){return a.jStore.FindEngine()}if(!b&&a.jStore.Instances.length>=1){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[0]);return a.jStore.CurrentEngine=a.jStore.Instances[0]}if(b&&a.jStore.Instances[b]){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[b]);return a.jStore.CurrentEngine=a.jStore.Instances[b]}throw"JSTORE_JRI_NO_MATCH"};a.jStore.FindEngine=function(){a.each(a.jStore.EngineOrder,function(b){if(a.jStore.Availability[this]()){a.jStore.use(this,a.jStore.defaults.project,"default");return false}})};a.jStore.store=function(b,c){if(!a.jStore.CurrentEngine){return false}if(!c){return a.jStore.CurrentEngine.get(b)}return a.jStore.CurrentEngine.set(b,c)};a.jStore.remove=function(b){if(!a.jStore.CurrentEngine){return false}return a.jStore.CurrentEngine.rem(b)};a.fn.store=function(c,d){if(!a.jStore.CurrentEngine){return this}var b=a.jStore.store(c,d);return !d?b:this};a.fn.removeStore=function(b){a.jStore.remove(b);return this};a.jStore.load=f unction(){if(a.jStore.defaults.engine){return a.jStore.use(a.jStore.defaults.engine,a.jStore.defaults.project,"default")}try{a.jStore.FindEngine()}catch(b){}}})(jQuery);(function(a){this.StorageEngine=Class.extend({init:function(c,b){this.project=c;this.jri=b;this.data={};this.limit=-1;this.includes=[];this.delegate=new jStoreDelegate(this).bind("engine-ready",function(){this.isReady=true}).bind("engine-included",function(){this.hasIncluded=true});this.autoload=false;this.isReady=false;this.hasIncluded=false},include:function(){var b=this,d=this.includes.length,c=0;a.each(this.includes,function(){a.ajax({type:"get",url:this,dataType:"script",cache:true,success:function(){c++;if(c==d){b.delegate.trigger("engine-included")}}})})},isAvailable:function(){return false},ready:function(b){if(this.isReady){b.apply(this)}else{this.delegate.bind("engine-ready",b)}return this},included:function(b){if(this.hasIncluded){b.apply(this)}else{this.delegate.bind("engine-included",b)}return th is},get:function(b){return this.data[b]||null},set:function(b,c){this.data[b]=c;return c},rem:function(b){var c=this.data[b];this.data[b]=null;return c}})})(jQuery); +/* + * jStore DOM Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(c){var b=c.jStore.Availability.session=function(){return !!window.sessionStorage},a=c.jStore.Availability.local=function(){return !!(window.localStorage||window.globalStorage)};this.jStoreDom=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="DOM";this.limit=5*1024*1024},connect:function(){this.delegate.trigger("engine-ready")},get:function(e){var d=this.db.getItem(e);return d&&d.value?d.value:d},set:function(d,e){this.db.setItem(d,e);return e},rem:function(e){var d=this.get(e);this.db.removeItem(e);return d}});this.jStoreLocal=jStoreDom.extend({connect:function(){this.db=!window.globalStorage?window.localStorage:window.globalStorage[location.hostname];this._super()},isAvailable:a});this.jStoreSession=jStoreDom.extend({connect:function(){this.db=sessionStorage;this._super()},isAvailable:b});c.jStore.Engines.local=jStoreLocal;c.jStore.Engines.session=jStoreSession;c.jStore.EngineOrder[1]="local"})(jQuery); +/* + * jStore Flash Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com) + */ +(function(b){var a=b.jStore.Availability.flash=function(){return !!(b.jStore.hasFlash("8.0.0"))};this.jStoreFlash=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="Flash";var c=this;b.jStore.flashReady(function(){c.flashReady()})},connect:function(){var c="jstore-flash-embed-"+this.project;b(document.body).append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" id="jStoreFlashFrame" src="'+b.jStore.defaults.flash+'"></iframe>')},flashReady:function(f){var c=b("#jStoreFlashFrame")[0];if(c.Document&&b.isFunction(c.Document.jStoreFlash.f_get_cookie)){this.db=c.Document.jStoreFlash}else{if(c.contentWindow&&c.contentWindow.document){var d=c.contentWindow.document;if(b.isFunction(b("object",b(d))[0].f_get_cookie)){this.db=b("object",b(d))[0]}else{if(b.isFunction(b("embed",b(d))[0].f_get_cookie)){this.db=b("embed",b(d))[0]}}}}if(this.db){this.delegate.trigger("engine-ready")}},isAvailable:a,get:function(d){var c=this.db.f_g et_cookie(d);return c=="null"?null:c},set:function(c,d){this.db.f_set_cookie(c,d);return d},rem:function(c){var d=this.get(c);this.db.f_delete_cookie(c);return d}});b.jStore.Engines.flash=jStoreFlash;b.jStore.EngineOrder[2]="flash";b.jStore.hasFlash=function(c){var e=b.jStore.flashVersion().match(/\d+/g),f=c.match(/\d+/g);for(var d=0;d<3;d++){e[d]=parseInt(e[d]||0);f[d]=parseInt(f[d]||0);if(e[d]<f[d]){return false}if(e[d]>f[d]){return true}}return true};b.jStore.flashVersion=function(){try{try{var c=new ActiveXObject("ShockwaveFlash.ShockwaveFlash.6");try{c.AllowScriptAccess="always"}catch(d){return"6,0,0"}}catch(d){}return new ActiveXObject("ShockwaveFlash.ShockwaveFlash").GetVariable("$version").replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}catch(d){try{if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){return(navigator.plugins["Shockwave Flash 2.0"]||navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}}catch(d){}}r eturn"0,0,0"}})(jQuery);function flash_ready(){$.jStore.delegate.trigger("flash-ready")} +/* + * jStore Google Gears Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.gears=function(){return !!(window.google&&window.google.gears)};this.jStoreGears=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="Google Gears";this.includes.push("http://code.google.com/apis/gears/gears_init.js");this.autoload=true},connect:function(){var c=this.db=google.gears.factory.create("beta.database");c.open("jstore-"+this.project);c.execute("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)");this.updateCache()},updateCache:function(){var c=this.db.execute("SELECT k,v FROM jstore");while(c.isValidRow()){this.data[c.field(0)]=c.field(1);c.next()}c.close();this.delegate.trigger("engine-ready")},isAvailable:a,set:function(d,e){var c=this.db;c.execute("BEGIN");c.execute("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[d,e]);c.execute("COMMIT");return this._super(d,e)},rem:function(d){var c=this.db;c.execute("BEGIN");c.execute("DELETE FROM jstore WHERE k = ?",[d]);c.ex ecute("COMMIT");return this._super(d)}});b.jStore.Engines.gears=jStoreGears;b.jStore.EngineOrder[3]="gears"})(jQuery); +/* + * jStore HTML5 Specification Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.html5=function(){return !!window.openDatabase};this.jStoreHtml5=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="HTML5";this.limit=1024*200},connect:function(){var c=this.db=openDatabase("jstore-"+this.project,"1.0",this.project,this.limit);if(!c){throw"JSTORE_ENGINE_HTML5_NODB"}c.transaction(function(d){d.executeSql("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)")});this.updateCache()},updateCache:function(){var c=this;this.db.transaction(function(d){d.executeSql("SELECT k,v FROM jstore",[],function(f,e){var h=e.rows,g=0,j;for(;g<h.length;++g){j=h.item(g);c.data[j.k]=j.v}c.delegate.trigger("engine-ready")})})},isAvailable:a,set:function(c,d){this.db.transaction(function(e){e.executeSql("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[c,d])});return this._super(c,d)},rem:function(c){this.db.transaction(function(d){d.executeSql("DELETE FROM jstore WHERE k = ?",[c])});ret urn this._super(c)}});b.jStore.Engines.html5=jStoreHtml5;b.jStore.EngineOrder[0]="html5"})(jQuery); +/** + * jStore IE Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.ie=function(){return !!window.ActiveXObject};this.jStoreIE=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="IE";this.limit=64*1024},connect:function(){this.db=b('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-'+this.project+'"></div>').appendTo(document.body).get(0);this.delegate.trigger("engine-ready")},isAvailable:a,get:function(c){this.db.load(this.project);return this.db.getAttribute(c)},set:function(c,d){this.db.setAttribute(c,d);this.db.save(this.project);return d},rem:function(c){var d=this.get(c);this.db.removeAttribute(c);this.db.save(this.project);return d}});b.jStore.Engines.ie=jStoreIE;b.jStore.EngineOrder[4]="ie"})(jQuery); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/packed/json2.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/packed/json2.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,1 @@ +var JSON=JSON||{};(function(){function f(n){return n<10?"0"+n:n}if(typeof Date.prototype.toJSON!=="function"){Date.prototype.toJSON=function(key){return isFinite(this.valueOf())?this.getUTCFullYear()+"-"+f(this.getUTCMonth()+1)+"-"+f(this.getUTCDate())+"T"+f(this.getUTCHours())+":"+f(this.getUTCMinutes())+":"+f(this.getUTCSeconds())+"Z":null};String.prototype.toJSON=Number.prototype.toJSON=Boolean.prototype.toJSON=function(key){return this.valueOf()}}var cx=/[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,escapable=/[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,gap,indent,meta={"\b":"\\b","\t":"\\t","\n":"\\n","\f":"\\f","\r":"\\r",'"':'\\"',"\\":"\\\\"},rep;function quote(string){escapable.lastIndex=0;return escapable.test(string)?'"'+string.replace(escapable,function(a){var c=meta[a];return typeof c==="string"?c:"\\u"+("0000"+a.charCodeAt(0) .toString(16)).slice(-4)})+'"':'"'+string+'"'}function str(key,holder){var i,k,v,length,mind=gap,partial,value=holder[key];if(value&&typeof value==="object"&&typeof value.toJSON==="function"){value=value.toJSON(key)}if(typeof rep==="function"){value=rep.call(holder,key,value)}switch(typeof value){case"string":return quote(value);case"number":return isFinite(value)?String(value):"null";case"boolean":case"null":return String(value);case"object":if(!value){return"null"}gap+=indent;partial=[];if(Object.prototype.toString.apply(value)==="[object Array]"){length=value.length;for(i=0;i<length;i+=1){partial[i]=str(i,value)||"null"}v=partial.length===0?"[]":gap?"[\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"]":"["+partial.join(",")+"]";gap=mind;return v}if(rep&&typeof rep==="object"){length=rep.length;for(i=0;i<length;i+=1){k=rep[i];if(typeof k==="string"){v=str(k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}else{for(k in value){if(Object.hasOwnProperty.call(value,k)){v=str( k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}v=partial.length===0?"{}":gap?"{\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"}":"{"+partial.join(",")+"}";gap=mind;return v}}if(typeof JSON.stringify!=="function"){JSON.stringify=function(value,replacer,space){var i;gap="";indent="";if(typeof space==="number"){for(i=0;i<space;i+=1){indent+=" "}}else{if(typeof space==="string"){indent=space}}rep=replacer;if(replacer&&typeof replacer!=="function"&&(typeof replacer!=="object"||typeof replacer.length!=="number")){throw new Error("JSON.stringify")}return str("",{"":value})}}if(typeof JSON.parse!=="function"){JSON.parse=function(text,reviver){var j;function walk(holder,key){var k,v,value=holder[key];if(value&&typeof value==="object"){for(k in value){if(Object.hasOwnProperty.call(value,k)){v=walk(value,k);if(v!==undefined){value[k]=v}else{delete value[k]}}}}return reviver.call(holder,key,value)}cx.lastIndex=0;if(cx.test(text)){text=text.replace(cx,function(a){return"\\u"+("000 0"+a.charCodeAt(0).toString(16)).slice(-4)})}if(/^[\],:{}\s]*$/.test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g,"@").replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g,"]").replace(/(?:^|:|,)(?:\s*\[)+/g,""))){j=eval("("+text+")");return typeof reviver==="function"?walk({"":j},""):j}throw new SyntaxError("JSON.parse")}}}()); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/center.mako --- a/templates/admin/center.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/center.mako Thu Aug 20 11:39:32 2009 -0400 @@ -17,7 +17,7 @@ <li> <strong>Manage groups</strong> - provides a view of all groups along with the members of the group and the roles associated with each group (both private and non-private roles). Non-private roles include a link to a page that allows you to manage the users - and groups that are associated with the role. The page also includes a view of the library datasets that are associated with the + and groups that are associated with the role. The page also includes a view of the data library datasets that are associated with the role and the permissions applied to each dataset. </li> <p/> @@ -32,9 +32,9 @@ <p/> <ul> <li> - <strong>Manage libraries</strong> - Dataset libraries enable a Galaxy administrator to upload datasets into a library. Currently, - only administrators can create dataset libraries, but permission to perform the following functions on the library can be granted to - users (a library item is one of: a library, a library folder, a library dataset). + <strong>Manage data libraries</strong> - Data libraries enable a Galaxy administrator to upload datasets into a data library. Currently, + only administrators can create data libraries, but permission to perform the following functions on the data library can be granted to + users (a library item is one of: a data library, a library folder, a library dataset). <p/> <ul> <li><strong>add library item</strong> - Role members can add library items to this library or folder</li> @@ -42,12 +42,12 @@ <li><strong>manage library permissions</strong> - Role members can manage permissions applied to this library item</li> </ul> <p/> - The default behavior is for no permissions to be applied to a library item, but applied permissions are inherited downward, so it is - important to set desired permissions on a new library when it is created. When this is done, new folders and datasets added to the - library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be + The default behavior is for no permissions to be applied to a data library item, but applied permissions are inherited downward, so it is + important to set desired permissions on a new data library when it is created. When this is done, new folders and datasets added to the + data library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be automatically inherited by all contained datasets and sub-folders. <p/> - The "Libraries" menu item allows users to access the datasets in a library as long as they are not restricted from accessing them. + The "Data Libraries" menu item allows users to access the datasets in a data library as long as they are not restricted from accessing them. Importing a library dataset into a history will not make a copy of the dataset, but will be a "pointer" to the dataset on disk. This approach allows for multiple users to use a single (possibly very large) dataset file. </li> @@ -72,7 +72,7 @@ </ul> </li> </ul> -<p><strong>Data Security and Dataset Libraries</strong></p> +<p><strong>Data Security and Data Libraries</strong></p> <p/> <strong>Security</strong> - Data security in Galaxy is a new feature, so familiarize yourself with the details which can be found here or in our <a href="http://g2.trac.bx.psu.edu/wiki/SecurityFeatures" target="_blank">data security page</a>. The data security @@ -121,8 +121,8 @@ <strong>access</strong> - users associated with the role can import this dataset into their history for analysis. <p> If no roles with the "access" permission are associated with a dataset, the dataset is "public" and may be accessed by - anyone. Public library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session) - from the list of libraries displayed when the "Libraries" menu item is selected. + anyone. Public data library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session) + from the list of data libraries displayed when the "Data Libraries" menu item is selected. </p> <p> Associating a dataset with a role that includes the "access" permission restricts the set of users that can access it. diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/dataset_security/role.mako --- a/templates/admin/dataset_security/role.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/dataset_security/role.mako Thu Aug 20 11:39:32 2009 -0400 @@ -84,7 +84,7 @@ <br clear="left"/> <br/> %if len( library_dataset_actions ) > 0: - <h3>Library datasets associated with role '${role.name}'</h3> + <h3>Data library datasets associated with role '${role.name}'</h3> <table class="manage-table colored" border="0" cellspacing="0" cellpadding="0" width="100%"> <tr> <td> diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/index.mako --- a/templates/admin/index.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/index.mako Thu Aug 20 11:39:32 2009 -0400 @@ -89,7 +89,7 @@ </div> <div class="toolSectionBody"> <div class="toolSectionBg"> - <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage libraries</a></div> + <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div> </div> </div> <div class="toolSectionPad"></div> diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/library/browse_libraries.mako --- a/templates/admin/library/browse_libraries.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/library/browse_libraries.mako Thu Aug 20 11:39:32 2009 -0400 @@ -1,19 +1,19 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<%def name="title()">Browse Libraries</%def> +<%def name="title()">Browse Data Libraries</%def> <h2> %if deleted: Deleted %endif - Libraries + Data Libraries </h2> <ul class="manage-table-actions"> %if not deleted: <li> - <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new data library</span></a> </li> <li> <a class="action-button" href="${h.url_for( controller='admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a> diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/library/browse_library.mako Thu Aug 20 11:39:32 2009 -0400 @@ -162,16 +162,16 @@ %if deleted: Deleted %endif - Library '${library.name}' + Data Library “${library.name}” </h2> <ul class="manage-table-actions"> %if not deleted: <li>