functional test failures
Hello, I am trying to have all functional tests on our production server (galaxy-dist 6621:26920e20157f) run successfully but I do still have failures that I do not know how to solve. Theses failures are related to unexpected differences probably due to versions of software that have been upgraded recently. ( Extract genomic DNA 1 ) > Test-1 ( Extract genomic DNA 1 ) > Test-2 ( Extract genomic DNA 1 ) > Test-3 ( Extract genomic DNA 1 ) > Test-4 ( Extract genomic DNA 1 ) > Test-5 ( GeneBed_Maf_Fasta2 ) > Test-1 ( Interval2Maf1 ) > Test-1 ( Interval2Maf1 ) > Test-3 ( Interval_Maf_Merged_Fasta2 ) > Test-1 ( Interval_Maf_Merged_Fasta2 ) > Test-2 ( LinearRegression1 ) > Test-1 ( XY_Plot_1 ) > Test-1 ( cca1 ) > Test-1 ( histogram_rpy ) > Test-1 ( kpca1 ) > Test-1 ( pca1 ) > Test-1 ( pca1 ) > Test-2 ( pca1 ) > Test-3 ( plot_for_lda_output1 ) > Test-1 ( qual_stats_boxplot ) > Test-1 AssertionError: History item 2 different than expected, difference (using diff) ( gops_join_1 ) > Test-4 TwillAssertionError: code is 500 != 200 I do also have failures due to missing data but I am struggling to find out where to download them. ( gd_select_snps ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error 'bighorn' does not appear in location file '/opt/local/home/webapp/galaxy/tool-data/gd.chrlens.loc' ( Annotation_Profiler_0 ) > Test-1 ( Annotation_Profiler_0 ) > Test-2 AssertionError: Configuration error: Table directory is missing (/opt/local/home/webapp/galaxy/tool-data/annotation_profiler/hg18) ( Interval2Maf_pairwise1 ) > Test-1 AssertionError: Attempting to set field 'mafType' to value '['PAIRWISE_hg17_fr1']' in form 'tool_form' threw exception: cannot find value/label "PAIRWISE_hg17_fr1" in list control ( maf_stats1 ) > Test-1 ( maf_stats1 ) > Test-2 AssertionError: Attempting to set field 'maf_source_type|mafType' to value '['8_WAY_MULTIZ_hg17']' in form 'tool_form' threw exception: cannot find value/label "8_WAY_MULTIZ_hg17" in list control ( phastOdds_for_intervals ) > Test-1 AssertionError: Attempting to set field 'score_file' to value '['/galaxy/data/phastOdds_precomputed/encode_SEP-2005_\ tba.v2_phastOdds']' in form 'tool_form' threw exception: cannot find value/label "/galaxy/data/phas..2_phastOdds" in li\ st control ( aggregate_scores_in_intervals2 ) > Test-1 ( aggregate_scores_in_intervals2 ) > Test-2 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error ( gencode_partition1 ) > Test-1 Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error Error loading partitioning dataset. ( lda_analy1 ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error The last failure is related to genome diversity and the fact that it calls python2.5. I've changed it to python for testing but the test still fails. ( gd_extract_flanking_dna ) > Test-1 ( gd_extract_primers ) > Test-1 ( gd_select_restriction_enzymes ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error python2.5: command not found
if changed to python: ERROR: 'NoneType' object has no attribute 'rfind'
Is there a way to fix these failures? Any help would be very much appreciated. Thanks, Anne. -- Anne Pajon, Ph.D. Cancer Research UK - Cambridge Research Institute Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE anne.pajon@cancer.org.uk | +44 (0)1223 404 334 NOTICE AND DISCLAIMER This e-mail (including any attachments) is intended for the above-named person(s). If you are not the intended recipient, notify the sender immediately, delete this email from your system and do not disclose or use for any purpose. We may monitor all incoming and outgoing emails in line with current legislation. We have taken steps to ensure that this email and attachments are free from any virus, but it remains your responsibility to ensure that viruses do not adversely affect you. Cancer Research UK Registered in England and Wales Company Registered Number: 4325234. Registered Charity Number: 1089464 and Scotland SC041666 Registered Office Address: Angel Building, 407 St John Street, London EC1V 4AD.
Hello, I am still working on trying to solve the failures that I have with some functional tests. I have been working today on Interval2Maf_pairwise1 functional test from the 'Extract Pairwise MAF blocks' tool (maf/interval2maf_pairwise.xml) and made some progress but I still do have a failure due to output differences. I would like to know if there are some documentation or even better some scripts for uploading tool's data locally in order to pass all functional tests. I've been looking into the wiki and within the Galaxy source code without much success. Below is what I have done and the output of the functional test. # install bx-python # edit ~/galaxy/tool-data/maf_pairwise.loc # Pairwise (hg17,fr1) PAIRWISE_hg17_fr1 hg17,fr1 hg17,fr1 /data_ls/galaxy/data/hg17/align/chr1.maf,/data_ls/galaxy/data/hg17/align/chrX.maf # download pairwise alignment cd /data_ls/galaxy/data/hg17/align wget ftp://hgdownload.cse.ucsc.edu/goldenPath/hg17/multiz8way/chr1.maf.gz gunzip chr1.maf.gz maf_build_index.py -s hg17 chr1.maf wget ftp://hgdownload.cse.ucsc.edu/goldenPath/hg17/multiz8way/chrX.maf.gz gunzip chrX.maf.gz maf_build_index.py -s hg17 chrX.maf # run functional test ./run_functional_tests.sh -id Interval2Maf_pairwise1 test_tool_000000 (functional.test_toolbox.TestForTool_Interval2Maf_pairwise1) Extract Pairwise MAF blocks ( Interval2Maf_pairwise1 ) > Test-1 ... galaxy.web.framework DEBUG 2012-02-23 18:13:09,955 Error: this request returned None from get_history(): http://localhost:9435/ galaxy.web.framework DEBUG 2012-02-23 18:13:10,000 Error: this request returned None from get_history(): http://localhost:9435/ galaxy.web.framework DEBUG 2012-02-23 18:13:10,059 Error: this request returned None from get_history(): http://localhost:9435/user/logout galaxy.web.framework DEBUG 2012-02-23 18:13:10,097 Error: this request returned None from get_history(): http://localhost:9435/ galaxy.tools.actions.upload_common INFO 2012-02-23 18:13:11,226 tool upload1 created job id 1 galaxy.jobs DEBUG 2012-02-23 18:13:19,603 (1) Working directory for job is: /opt/local/home/webapp/galaxy/database/job_working_directory/000/1 galaxy.jobs DEBUG 2012-02-23 18:13:19,603 dispatching job 1 to local runner galaxy.jobs INFO 2012-02-23 18:13:19,735 job 1 dispatched galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:19,945 executing: python /opt/local/home/webapp/galaxy/tools/data_source/upload.py /opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 /data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf 1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:20,828 execution finished: python /opt/local/home/webapp/galaxy/tools/data_source/upload.py /opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 /data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf 1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat galaxy.jobs DEBUG 2012-02-23 18:13:21,002 job 1 ended galaxy.jobs DEBUG 2012-02-23 18:13:25,288 (2) Working directory for job is: /opt/local/home/webapp/galaxy/database/job_working_directory/000/2 galaxy.jobs DEBUG 2012-02-23 18:13:25,288 dispatching job 2 to local runner galaxy.jobs INFO 2012-02-23 18:13:25,411 job 2 dispatched galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:27,379 executing: python /opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 --chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 --interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat --output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat --indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc galaxy.jobs.runners.local DEBUG 2012-02-23 18:13:28,743 execution finished: python /opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 --chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 --interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat --output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat --indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc galaxy.jobs DEBUG 2012-02-23 18:13:30,404 job 2 ended base.twilltestcase INFO 2012-02-23 18:13:30,863 ## files diff on /opt/local/home/webapp/galaxy/test-data/Interval2Maf_pairwise_out.maf and /data_ls/tmp/tmpmYp_1L/database/tmp/tmplBoXcFInterval2Maf_pairwise_out.maf lines_diff=0, found diff = 5256 ---------------------- >> begin tool stdout << ----------------------- 968 MAF blocks extracted for 1 regions. ----------------------- >> end tool stdout << ------------------------ ---------------------- >> begin tool stderr << ----------------------- ----------------------- >> end tool stderr << ------------------------ FAIL ====================================================================== FAIL: test_tool_000000 (functional.test_toolbox.TestForTool_Interval2Maf_pairwise1) Extract Pairwise MAF blocks ( Interval2Maf_pairwise1 ) > Test-1 ---------------------------------------------------------------------- Traceback (most recent call last): File "/opt/local/home/webapp/galaxy/test/functional/test_toolbox.py", line 162, in test_tool self.do_it( td ) File "/opt/local/home/webapp/galaxy/test/functional/test_toolbox.py", line 97, in do_it self.verify_dataset_correctness( outfile, hid=elem_hid, maxseconds=testdef.maxseconds, attributes=attributes ) File "/opt/local/home/webapp/galaxy/test/base/twilltestcase.py", line 715, in verify_dataset_correctness raise AssertionError( errmsg ) AssertionError: History item 2 different than expected, difference (using diff): --- local_file +++ history_data @@ -1,49 +1,5209 @@ ##maf version=1 -a score=10458 -s hg17.chrX 3816458 525 - 154824264 tGATGCACGTTTTCTCTTTTCATACTCATCTT--CAGTTATTCCTTGACACAAACCTGGTTA---CTAGTGCTATTGGCTACATGGCCCCTGTGCCTTAACTTCCCTCATGGCTCCTCCTCCCTGCAGCCTCTGAAGGTTCTCTGTGTAATGAATT--AATTAGCTTTGCTTTTTTCTCCCTTTCCCCC-----CCTCTTTTTCCTGGCCTCT---------AGAAGAAAACACCAGCAGCCCCAGCAAAGAAAACCAGCACTACCTTCAACATCGTGGGGACCACCTATCCCATCAACCTGGCCAAGGACACTGAATTTTCCACCATCTCCAAGGGCGCTGCTCCCAGTGCCTCCTCAACCCCAACAATCATTGCTTCACCCAAGGCCACCTACGTGCAGGACAGCCCGACTGAGACCAAGA---CCTACAACAGTGTCAGCAAGGTTGACAAAATTTCCCGCATCATCTTTCCTGTGCTCTTTGCCATATTCAATCTGGTCTATTGGGCCACATATGTCAACCGGGAGTCAGCTATCAAGGGCATGA -s fr1.chrUn 343715247 529 - 349519338 TGGTCAACATTTTTTTCTTTTCTACTTTTCTTTTCAGGAACCGTTTCAGGCTAACATGGCCAGGATTAAAGATAT-GGTTAGGCTTTTGTTTTGTTCTTGTGTGTGTCGTGTCTCGTGGT----GTTGCTTCTATTTCCTCTTCATGAGTTCAAATGGAAGTATTGTTAAGTTTGTTGCCCCCGACCCTAACGACCTCTGCTTTATGGCCTCTTCTCTTTTCAGAGGAGAGAATCTGAGAATCTGACCAAAAAGACGAACAACACCTTCAACATCGTCGGGACGACCTACGCCATCAACGTGGCGAAGGACCAGGGCTTAACCACCATCTCCAAAAGCGCCACCACCGGCGCGCC----GGCCAAACAGCACTACCTGCACAAAA-----------TGGACGACCCCTACACAGAGGCCAAGAAATCCTACAACCGAGTCAGCATAGTGGACAAAATATCACGCATCATTTTCCCAGTTCTGTTCTTCATCTTCAACTTGGGCTACTGGGCCACATATATCAACAGGAAGCCCATTATTATGAACGCGA - -a score=12779 -s hg17.chrX 3795168 357 - 154824264 aGGGCCATTTTGAGTGGGGTAAAGCTTCTCCTTTCAAATAGGAAA----TTAGTGATTTCATCG--AATAAGC-------TCTCAATGTCTTCCAGTTGCAACTGGTTCTCATCTTTCCTCT----CCTCAGGTGTCACCACTGTGCTTACCATGACCACCTTGAGTATCAGTGCCAGAAATTCCTTACCTAAAGTGGCATATGCGACGGCCATGGACTGGTTCATAGCCGTCTGTTATGCCTTTGTATTTTCTGCACTGATTGAATTTGCCACTGTCAACTATTTCACCAAGCGGAGTTGGGCTTGGGAAGGCAAGAAGGTGCCAGAGGCCCTGGAGATGAAGGTGAGATA----TAGCAAAAGAGAAACTGAGAAG -s fr1.chrUn 343710815 364 - 349519338 TGAGCCAATTT--------TGAAGTGACAATTTTCAAATGTGCCACATTTTAGTAGCAGCAAAGTCAGAAAGCGACTTTTCCTCTACATCACTTCTCTGATCTGTGTTCTGATGTTTTCCTTTCATCCTCAGGGGTCACCACTGTGCTTACCATGACCACCCTGAGCATCAGTGCTAGAAACTCCCTCCCTAAGGTGGCCTACGCCACCGCCATGGACTGGTTCATGGCGGTGTGCTACGCCTTTGTCTTCTCTGCCTTGATTGAGTTTGCGACGGTCAACTACTTCACCAAACGCAGCTGGGCATGGGATGGGAAAAA------AGAGGGCATGGAAATAAGGGTGAGTGATTTTTAATCAAATATATACTGATACG - -a score=10363 -s hg17.chrX 3787425 174 - 154824264 TACTCTCTCTTTAGGAGAATATGTCGTCATGACAACCCACTTCCATCTCAAGCGAAAAATTGGCTACTTTGTGATCCAGACCTACTTGCCATGTATCATGACTGTCATTCTGTCACAAGTGTCGTTCTGGCTCAACAGAGAGTCTGTTCCTGCCCGTACAGTCTTTGGTGAGTG -s fr1.chrUn 343708230 174 - 349519338 TCCTCCCGCTGCAGGCGAATATGTTGTGATGACAACATATTTCCATTTGAAAAGGAAAATTGGCTATTTCGTGATTCAAACCTACCTCCCGTGCATCATGACTGTCATTCTGTCTCAAGTCTCCTTCTGGCTGAACCGAGAATCGGTCCCTGCTCGCACCGTGTTCGGTGAGTG - -a score=31 -s hg17.chrX 3787284 100 - 154824264 ATTTTGTGATTATTAAAGGGCTCTAGTTATATGAACTTGGGAGATGCTGGAATATTGAATATAAG----ATTAAAGAGCTTTGTGAAT--------TGAATT-----GGGGCCCAAC -s fr1.chrUn 62078707 109 - 349519338 AGTTTGTGAGGCCTAAATGCCAAAAGT-------ACTTGA-ACAGGCTTAAGAATGGATCATGAATTTTCTTAAATAAATCTGTTAATCCAGAAAGTAAACTCTGGGGGGGTCCAGA - -a score=4963 -s hg17.chrX 3776942 285 - 154824264 aCTTCAGTTGAAGACAGACCACATACCCAGAACTCTTTGAAGATGGAAGTTTTATTTCGATCTCATTTGAGTTTAGTATCAAGGGTAATCATTCTCCATTTCCTTCAACTTCTCTTTATTGACCCTTCTCTGCC--TTAGATGCCTATACAACAGCTGAAGTGGTTTATTCTTGGACTCTCGGAAAGAACAAATCCGTGGAAGTGGCACAGGATGGTTCTCGCTTGAACCAGTATGACCTTTTGGGCCATGTTGTTGGGACAGAGATAATCCGGTCTAGTACAGGTA -s fr1.chrUn 343707053 283 - 349519338 AACTTAAATCAACACCAAGTAAAGGCAAAGAATCTTTTAAACTAAGAA----TCTATTAAACTAGATAAACTAAAGCATCGACACTGACGCGTTGATCTGTCATCCACGTTTCCCCTGTTTCCTTTCCTTCTCCATCTAGACGCTTACACCAACAATGAGGTGATTTACCTGTGGACTCAGGGGGACGAGAGGTCTGTGTCTGTCGCAGAGGACGGCTCCAGGCTGAACCAGTATGATTTACTGGGACACGTTATTGGCAAAGAAACCATCAGCTCCAGCACAGGTA - -a score=5912 -s hg17.chrX 3760375 93 - 154824264 TTAGGTTAACAATTCATGCTGAGTGTCCCATGCATTTGGAAGATTTTCCCATGGATGTGCATGCCTGCCCACTGAAGTTTGGAAGCTGTATGT -s fr1.chrUn 343706399 93 - 349519338 TCAGGTTGACCATCCACGCTGAGTGCCCCATGCACCTGGAGGACTTCCCCATGGACTCGCACGCCTGTCCTCTCAAGTTTGGAAGTTGTAAGT - -a score=4332 -s hg17.chrX 3733405 476 - 154824264 ATCAAGGAGAATTTGGGGAAACAGAGCATTAGGGAAGGAATAGATGGAAGAGAGGCATGCTTGTAATAAATTATAGGAAAGAGAAGAGTTTGAAAAAGAGATAAGAGTTCACACAATTGTGGAAAGAATGGAGTGGAGTATATGTAAACAGAAAAGAAGCTGTATGGAATGAGGTGGATGGAGGGACAGAATAATGAGGAGGAGAT---GTGGATGGGCAGAAGACAGTAAGCAAATGGAAGAGAAGCAAGA-----GGAAGGAGAGAGTAATGGGCAGGAAAGGATCTGAACCCAGTAGAGATTGCAAATAGTGAGGAGAAATAGAGAATGAATGAAAAGAACAGG--ATAGAGGAGAAACAACAATAAAAGGAATAAAGCATAGAGAATAGGTTTAAGTTTTGGAGGAGGGATAGAGAA-----GAGAGAAGAAAGGAGAGAGGATGGGAATATTGAAATACAAAAAAATAGAAGGTGCAGGTTGAGGA -s fr1.chrUn 303515824 444 + 349519338 AACACGGAATATGGAGGGAAAACGGGGAATATGGAGGGAACAG--GGAATATGG-------------------TGGGAACACAGAGGGAATATGGAGGGAACACGGG-------GAATATGGAGGGAA---AACGGGGAATATGGAGGGAACGGGGAATATGGAGGGAACGAGGAATATGGAGGGAACGGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACGAGGAATATGGAGGGAACACAGGGAATATGGAGGGAACGAGGAATATGGAGGGAACACAGGGAAT--ATGGAGGGAACGGGGAATATGGAGGGAACACAGGGAATATGGAGGGAACACAGGGAATAT--------------GGAGGGAACGAGGAATATGGAGGGAACACAGGGAATATGGAGGGAACGAGGAATATGGAGGGAACACGGGGTACTCAGTGAGAA - -a score=719 -s hg17.chrX 3731355 108 - 154824264 TATGTAAGTAGAATGCAGTCAAGAAACTTGTAGGTGGATAGGTAGAGGCAGAAGGAAGAGAGGAAGGACGTTCTAGACAGAGAAAACCAAGTGAGCAGTTGCAGGGAA -s fr1.chrUn 303515724 91 + 349519338 TATGGAGGGAACACG------GGGAATATGGAGG-GAATATAGAGGGGAGACGGGGAATATGGAGGGA------ACACGGGGAATATGGAGGGAACA----CAGGGAA - -a score=3647 -s hg17.chrX 3730591 447 - 154824264 CAAGGAAAAAAGGATAATACTTCAGAGAGAAGTTGGATGAGAGATGGGAGGAA--AAATGAACATAGAGGAGAAATGAGCATAGAGTGGAGGATAAAATAATGAAGAAGGAAAGTGGATAGAAGTGGGAAGATGAGGGTCAAGAGGGGAGGAGAAGACTAATTACACAGAGTACATAGAGGCATGTATATTGGAGAAATGAGAATGGTGAAAAGAAAGAGAGTATGAGAAGAGAGGACAAAAAGAGTAGAGAAGTTGAGAAGACAAAGGATAAGATGGTGTAAAATAAAGAAGCTAGATTAGATATTAGGATATTCTAAAGAGATAGGCGAATATAATGAAGTGGATGTAGTAGATGGGAATAAAGAGGAAAAGACATAGAGAAGTAGGGGAAGGGACATGGGAGGAGATGAACAAGAGGGAGGGAAATTGTAGACGAAAGAAAGAGAA -s fr1.chrUn 303515378 346 + 349519338 CACGGGGAATATGGCGGGAACACAGAGGGAATATGGAGGGAACACGGGGAATATGGAGGGAATATAGAGGGGAGACGGG--GAATATGGAGGG-AACATGGGGAATATGGAGGGAATATAGA---GGGGAGACGGGGAATATGGAGGGA--------------ACACGGGGAATATGGAGG---GAACACAGG------GAATATGGCGGGAACACAGGGAATATG----GAGGGAACACGGGGAATATGGAGG----GAACACAGGGAATATGGAGG----AAATATAGAGGGAAAACGGGAAAT------------------------------ATGGAGGGAATATGGT----GGGAACACAGGGAATA----------------TGGAGGGAACACGGGG----------AATATGGAGGGAA--TATAGAGGGGAGACGGGGAA - -------------------- >> begin captured stdout << --------------------- Uploaded file: 8.bed , ftype: auto , extra: {'value': '8.bed', 'children': [], 'dbkey': 'hg17', 'format': 'bed'} form 'tool_form' contains the following controls ( note the values ) control 0: <HiddenControl(tool_id=Interval2Maf_pairwise1) (readonly)> control 1: <HiddenControl(tool_state=800255ad616630373336623066396637653065636434343038306566306666326436306338613664643932303a37623232356635663730363136373635356635663232336132303330326332303232366436313636353437393730363532323361323032323563323235303431343935323537343935333435356636383637333133373566363637323331356332323232326332303232363936653730373537343331323233613230323233313232376471002e) (readonly)> control 2: <SelectControl(input1=[*1])> control 3: <SelectControl(mafType=[*PAIRWISE_hg17_fr1])> control 4: <SubmitControl(runtool_btn=Execute) (readonly)> page_inputs (0) {'mafType': ['PAIRWISE_hg17_fr1'], 'input1': ['8.bed']} --------------------- >> end captured stdout << ---------------------- -------------------- >> begin captured logging << -------------------- galaxy.web.framework: DEBUG: Error: this request returned None from get_history(): http://localhost:9435/ galaxy.web.framework: DEBUG: Error: this request returned None from get_history(): http://localhost:9435/ galaxy.web.framework: DEBUG: Error: this request returned None from get_history(): http://localhost:9435/user/logout galaxy.web.framework: DEBUG: Error: this request returned None from get_history(): http://localhost:9435/ galaxy.tools.actions.upload_common: INFO: tool upload1 created job id 1 galaxy.jobs: DEBUG: (1) Working directory for job is: /opt/local/home/webapp/galaxy/database/job_working_directory/000/1 galaxy.jobs: DEBUG: dispatching job 1 to local runner galaxy.jobs: INFO: job 1 dispatched galaxy.jobs.runners.local: DEBUG: executing: python /opt/local/home/webapp/galaxy/tools/data_source/upload.py /opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 /data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf 1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat galaxy.jobs.runners.local: DEBUG: execution finished: python /opt/local/home/webapp/galaxy/tools/data_source/upload.py /opt/local/home/webapp/galaxy /data_ls/tmp/tmpmYp_1L/database/tmp/tmpqz25f2 /data_ls/tmp/tmpmYp_1L/database/tmp/tmp4USGnf 1:/opt/local/home/webapp/galaxy/database/job_working_directory/000/1/dataset_1_files:/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat galaxy.jobs: DEBUG: job 1 ended galaxy.jobs: DEBUG: (2) Working directory for job is: /opt/local/home/webapp/galaxy/database/job_working_directory/000/2 galaxy.jobs: DEBUG: dispatching job 2 to local runner galaxy.jobs: INFO: job 2 dispatched galaxy.jobs.runners.local: DEBUG: executing: python /opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 --chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 --interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat --output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat --indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc galaxy.jobs.runners.local: DEBUG: execution finished: python /opt/local/home/webapp/galaxy/tools/maf/interval2maf.py --dbkey=hg17 --chromCol=1 --startCol=2 --endCol=3 --strandCol=6 --mafType=PAIRWISE_hg17_fr1 --interval_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_1.dat --output_file=/data_ls/tmp/tmpmYp_1L/database/files/000/dataset_2.dat --indexLocation=/opt/local/home/webapp/galaxy/tool-data/maf_pairwise.loc galaxy.jobs: DEBUG: job 2 ended base.twilltestcase: INFO: ## files diff on /opt/local/home/webapp/galaxy/test-data/Interval2Maf_pairwise_out.maf and /data_ls/tmp/tmpmYp_1L/database/tmp/tmplBoXcFInterval2Maf_pairwise_out.maf lines_diff=0, found diff = 5256 --------------------- >> end captured logging << --------------------- ---------------------------------------------------------------------- Ran 1 test in 21.136s FAILED (failures=1) functional_tests.py INFO 2012-02-23 18:13:31,065 Shutting down functional_tests.py INFO 2012-02-23 18:13:31,065 Shutting down embedded web server functional_tests.py INFO 2012-02-23 18:13:31,068 Embedded web server stopped functional_tests.py INFO 2012-02-23 18:13:31,068 Shutting down app galaxy.jobs INFO 2012-02-23 18:13:31,068 sending stop signal to worker thread galaxy.jobs INFO 2012-02-23 18:13:31,068 job queue stopped galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,069 sending stop signal to worker threads galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,069 local job runner stopped galaxy.jobs INFO 2012-02-23 18:13:31,069 sending stop signal to worker thread galaxy.jobs INFO 2012-02-23 18:13:31,069 job stopper stopped functional_tests.py INFO 2012-02-23 18:13:31,070 Embedded Universe application stopped functional_tests.py INFO 2012-02-23 18:13:31,070 Cleaning up temporary files in /data_ls/tmp/tmpmYp_1L galaxy.jobs INFO 2012-02-23 18:13:31,922 sending stop signal to worker thread galaxy.jobs INFO 2012-02-23 18:13:31,923 job queue stopped galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,923 sending stop signal to worker threads galaxy.jobs.runners.local INFO 2012-02-23 18:13:31,923 local job runner stopped galaxy.jobs INFO 2012-02-23 18:13:31,923 sending stop signal to worker thread galaxy.jobs INFO 2012-02-23 18:13:31,923 job stopper stopped Exception OSError: (2, 'No such file or directory', '/data_ls/tmp/tmpmYp_1L/database/tmp/tmpcORjQS') in <bound method _TemporaryFileWrapper.__del__ of <closed file '<fdopen>', mode 'w' at 0x2aa80780>> ignored 'run_functional_tests.sh help' for help Note: galaxy test framework uses tool_conf.xml.sample, not tool_conf.xml Thanks for your help. Anne. On 20 Feb 2012, at 18:25, Anne Pajon wrote:
Hello,
I am trying to have all functional tests on our production server (galaxy-dist 6621:26920e20157f) run successfully but I do still have failures that I do not know how to solve.
Theses failures are related to unexpected differences probably due to versions of software that have been upgraded recently.
( Extract genomic DNA 1 ) > Test-1 ( Extract genomic DNA 1 ) > Test-2 ( Extract genomic DNA 1 ) > Test-3 ( Extract genomic DNA 1 ) > Test-4 ( Extract genomic DNA 1 ) > Test-5 ( GeneBed_Maf_Fasta2 ) > Test-1 ( Interval2Maf1 ) > Test-1 ( Interval2Maf1 ) > Test-3 ( Interval_Maf_Merged_Fasta2 ) > Test-1 ( Interval_Maf_Merged_Fasta2 ) > Test-2 ( LinearRegression1 ) > Test-1 ( XY_Plot_1 ) > Test-1 ( cca1 ) > Test-1 ( histogram_rpy ) > Test-1 ( kpca1 ) > Test-1 ( pca1 ) > Test-1 ( pca1 ) > Test-2 ( pca1 ) > Test-3 ( plot_for_lda_output1 ) > Test-1 ( qual_stats_boxplot ) > Test-1 AssertionError: History item 2 different than expected, difference (using diff)
( gops_join_1 ) > Test-4 TwillAssertionError: code is 500 != 200
I do also have failures due to missing data but I am struggling to find out where to download them.
( gd_select_snps ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error 'bighorn' does not appear in location file '/opt/local/home/webapp/galaxy/tool-data/gd.chrlens.loc'
( Annotation_Profiler_0 ) > Test-1 ( Annotation_Profiler_0 ) > Test-2 AssertionError: Configuration error: Table directory is missing (/opt/local/home/webapp/galaxy/tool-data/annotation_profiler/hg18)
( Interval2Maf_pairwise1 ) > Test-1 AssertionError: Attempting to set field 'mafType' to value '['PAIRWISE_hg17_fr1']' in form 'tool_form' threw exception: cannot find value/label "PAIRWISE_hg17_fr1" in list control
( maf_stats1 ) > Test-1 ( maf_stats1 ) > Test-2 AssertionError: Attempting to set field 'maf_source_type|mafType' to value '['8_WAY_MULTIZ_hg17']' in form 'tool_form' threw exception: cannot find value/label "8_WAY_MULTIZ_hg17" in list control
( phastOdds_for_intervals ) > Test-1 AssertionError: Attempting to set field 'score_file' to value '['/galaxy/data/phastOdds_precomputed/encode_SEP-2005_\ tba.v2_phastOdds']' in form 'tool_form' threw exception: cannot find value/label "/galaxy/data/phas..2_phastOdds" in li\ st control
( aggregate_scores_in_intervals2 ) > Test-1 ( aggregate_scores_in_intervals2 ) > Test-2 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
( gencode_partition1 ) > Test-1 Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error Error loading partitioning dataset.
( lda_analy1 ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
The last failure is related to genome diversity and the fact that it calls python2.5. I've changed it to python for testing but the test still fails.
( gd_extract_flanking_dna ) > Test-1 ( gd_extract_primers ) > Test-1 ( gd_select_restriction_enzymes ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error python2.5: command not found
if changed to python: ERROR: 'NoneType' object has no attribute 'rfind'
Is there a way to fix these failures? Any help would be very much appreciated. Thanks, Anne.
-- Anne Pajon, Ph.D. Cancer Research UK - Cambridge Research Institute Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE anne.pajon@cancer.org.uk | +44 (0)1223 404 334
-- Anne Pajon, Ph.D. Cancer Research UK - Cambridge Research Institute Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE anne.pajon@cancer.org.uk | +44 (0)1223 404 334 NOTICE AND DISCLAIMER This e-mail (including any attachments) is intended for the above-named person(s). If you are not the intended recipient, notify the sender immediately, delete this email from your system and do not disclose or use for any purpose. We may monitor all incoming and outgoing emails in line with current legislation. We have taken steps to ensure that this email and attachments are free from any virus, but it remains your responsibility to ensure that viruses do not adversely affect you. Cancer Research UK Registered in England and Wales Company Registered Number: 4325234. Registered Charity Number: 1089464 and Scotland SC041666 Registered Office Address: Angel Building, 407 St John Street, London EC1V 4AD.
Hi Anne, We're aware that many tests require certain local data to be set up beforehand. As such, these tests can't really be run at a local site. As part of relocating our tools to the tool shed, we hope to fix this issue. Thanks, --nate On Feb 20, 2012, at 1:25 PM, Anne Pajon wrote:
Hello,
I am trying to have all functional tests on our production server (galaxy-dist 6621:26920e20157f) run successfully but I do still have failures that I do not know how to solve.
Theses failures are related to unexpected differences probably due to versions of software that have been upgraded recently.
( Extract genomic DNA 1 ) > Test-1 ( Extract genomic DNA 1 ) > Test-2 ( Extract genomic DNA 1 ) > Test-3 ( Extract genomic DNA 1 ) > Test-4 ( Extract genomic DNA 1 ) > Test-5 ( GeneBed_Maf_Fasta2 ) > Test-1 ( Interval2Maf1 ) > Test-1 ( Interval2Maf1 ) > Test-3 ( Interval_Maf_Merged_Fasta2 ) > Test-1 ( Interval_Maf_Merged_Fasta2 ) > Test-2 ( LinearRegression1 ) > Test-1 ( XY_Plot_1 ) > Test-1 ( cca1 ) > Test-1 ( histogram_rpy ) > Test-1 ( kpca1 ) > Test-1 ( pca1 ) > Test-1 ( pca1 ) > Test-2 ( pca1 ) > Test-3 ( plot_for_lda_output1 ) > Test-1 ( qual_stats_boxplot ) > Test-1 AssertionError: History item 2 different than expected, difference (using diff)
( gops_join_1 ) > Test-4 TwillAssertionError: code is 500 != 200
I do also have failures due to missing data but I am struggling to find out where to download them.
( gd_select_snps ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error 'bighorn' does not appear in location file '/opt/local/home/webapp/galaxy/tool-data/gd.chrlens.loc'
( Annotation_Profiler_0 ) > Test-1 ( Annotation_Profiler_0 ) > Test-2 AssertionError: Configuration error: Table directory is missing (/opt/local/home/webapp/galaxy/tool-data/annotation_profiler/hg18)
( Interval2Maf_pairwise1 ) > Test-1 AssertionError: Attempting to set field 'mafType' to value '['PAIRWISE_hg17_fr1']' in form 'tool_form' threw exception: cannot find value/label "PAIRWISE_hg17_fr1" in list control
( maf_stats1 ) > Test-1 ( maf_stats1 ) > Test-2 AssertionError: Attempting to set field 'maf_source_type|mafType' to value '['8_WAY_MULTIZ_hg17']' in form 'tool_form' threw exception: cannot find value/label "8_WAY_MULTIZ_hg17" in list control
( phastOdds_for_intervals ) > Test-1 AssertionError: Attempting to set field 'score_file' to value '['/galaxy/data/phastOdds_precomputed/encode_SEP-2005_\ tba.v2_phastOdds']' in form 'tool_form' threw exception: cannot find value/label "/galaxy/data/phas..2_phastOdds" in li\ st control
( aggregate_scores_in_intervals2 ) > Test-1 ( aggregate_scores_in_intervals2 ) > Test-2 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
( gencode_partition1 ) > Test-1 Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error Error loading partitioning dataset.
( lda_analy1 ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
The last failure is related to genome diversity and the fact that it calls python2.5. I've changed it to python for testing but the test still fails.
( gd_extract_flanking_dna ) > Test-1 ( gd_extract_primers ) > Test-1 ( gd_select_restriction_enzymes ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error python2.5: command not found
if changed to python: ERROR: 'NoneType' object has no attribute 'rfind'
Is there a way to fix these failures? Any help would be very much appreciated. Thanks, Anne.
-- Anne Pajon, Ph.D. Cancer Research UK - Cambridge Research Institute Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE anne.pajon@cancer.org.uk | +44 (0)1223 404 334
NOTICE AND DISCLAIMER This e-mail (including any attachments) is intended for the above-named person(s). If you are not the intended recipient, notify the sender immediately, delete this email from your system and do not disclose or use for any purpose.
We may monitor all incoming and outgoing emails in line with current legislation. We have taken steps to ensure that this email and attachments are free from any virus, but it remains your responsibility to ensure that viruses do not adversely affect you. Cancer Research UK Registered in England and Wales Company Registered Number: 4325234. Registered Charity Number: 1089464 and Scotland SC041666 Registered Office Address: Angel Building, 407 St John Street, London EC1V 4AD.
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at:
Hi Nate, Thanks for your answer. I am looking forward at the relocation of the tools to the tool shed then. Cheers, Anne. On 26 Mar 2012, at 14:49, Nate Coraor wrote:
Hi Anne,
We're aware that many tests require certain local data to be set up beforehand. As such, these tests can't really be run at a local site. As part of relocating our tools to the tool shed, we hope to fix this issue.
Thanks, --nate
On Feb 20, 2012, at 1:25 PM, Anne Pajon wrote:
Hello,
I am trying to have all functional tests on our production server (galaxy-dist 6621:26920e20157f) run successfully but I do still have failures that I do not know how to solve.
Theses failures are related to unexpected differences probably due to versions of software that have been upgraded recently.
( Extract genomic DNA 1 ) > Test-1 ( Extract genomic DNA 1 ) > Test-2 ( Extract genomic DNA 1 ) > Test-3 ( Extract genomic DNA 1 ) > Test-4 ( Extract genomic DNA 1 ) > Test-5 ( GeneBed_Maf_Fasta2 ) > Test-1 ( Interval2Maf1 ) > Test-1 ( Interval2Maf1 ) > Test-3 ( Interval_Maf_Merged_Fasta2 ) > Test-1 ( Interval_Maf_Merged_Fasta2 ) > Test-2 ( LinearRegression1 ) > Test-1 ( XY_Plot_1 ) > Test-1 ( cca1 ) > Test-1 ( histogram_rpy ) > Test-1 ( kpca1 ) > Test-1 ( pca1 ) > Test-1 ( pca1 ) > Test-2 ( pca1 ) > Test-3 ( plot_for_lda_output1 ) > Test-1 ( qual_stats_boxplot ) > Test-1 AssertionError: History item 2 different than expected, difference (using diff)
( gops_join_1 ) > Test-4 TwillAssertionError: code is 500 != 200
I do also have failures due to missing data but I am struggling to find out where to download them.
( gd_select_snps ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error 'bighorn' does not appear in location file '/opt/local/home/webapp/galaxy/tool-data/gd.chrlens.loc'
( Annotation_Profiler_0 ) > Test-1 ( Annotation_Profiler_0 ) > Test-2 AssertionError: Configuration error: Table directory is missing (/opt/local/home/webapp/galaxy/tool-data/annotation_profiler/hg18)
( Interval2Maf_pairwise1 ) > Test-1 AssertionError: Attempting to set field 'mafType' to value '['PAIRWISE_hg17_fr1']' in form 'tool_form' threw exception: cannot find value/label "PAIRWISE_hg17_fr1" in list control
( maf_stats1 ) > Test-1 ( maf_stats1 ) > Test-2 AssertionError: Attempting to set field 'maf_source_type|mafType' to value '['8_WAY_MULTIZ_hg17']' in form 'tool_form' threw exception: cannot find value/label "8_WAY_MULTIZ_hg17" in list control
( phastOdds_for_intervals ) > Test-1 AssertionError: Attempting to set field 'score_file' to value '['/galaxy/data/phastOdds_precomputed/encode_SEP-2005_\ tba.v2_phastOdds']' in form 'tool_form' threw exception: cannot find value/label "/galaxy/data/phas..2_phastOdds" in li\ st control
( aggregate_scores_in_intervals2 ) > Test-1 ( aggregate_scores_in_intervals2 ) > Test-2 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
( gencode_partition1 ) > Test-1 Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error Error loading partitioning dataset.
( lda_analy1 ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error
The last failure is related to genome diversity and the fact that it calls python2.5. I've changed it to python for testing but the test still fails.
( gd_extract_flanking_dna ) > Test-1 ( gd_extract_primers ) > Test-1 ( gd_select_restriction_enzymes ) > Test-1 AssertionError: Expecting dataset state 'ok', but state is 'error'. Dataset blurb: error python2.5: command not found
if changed to python: ERROR: 'NoneType' object has no attribute 'rfind'
Is there a way to fix these failures? Any help would be very much appreciated. Thanks, Anne.
-- Anne Pajon, Ph.D. Cancer Research UK - Cambridge Research Institute Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE anne.pajon@cancer.org.uk | +44 (0)1223 404 334
NOTICE AND DISCLAIMER This e-mail (including any attachments) is intended for the above-named person(s). If you are not the intended recipient, notify the sender immediately, delete this email from your system and do not disclose or use for any purpose.
We may monitor all incoming and outgoing emails in line with current legislation. We have taken steps to ensure that this email and attachments are free from any virus, but it remains your responsibility to ensure that viruses do not adversely affect you. Cancer Research UK Registered in England and Wales Company Registered Number: 4325234. Registered Charity Number: 1089464 and Scotland SC041666 Registered Office Address: Angel Building, 407 St John Street, London EC1V 4AD.
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Anne Pajon, Ph.D. Cancer Research UK - Cambridge Research Institute Li Ka Shing Centre, Robinson Way, Cambridge CB2 0RE anne.pajon@cancer.org.uk | +44 (0)1223 404 334 NOTICE AND DISCLAIMER This e-mail (including any attachments) is intended for the above-named person(s). If you are not the intended recipient, notify the sender immediately, delete this email from your system and do not disclose or use for any purpose. We may monitor all incoming and outgoing emails in line with current legislation. We have taken steps to ensure that this email and attachments are free from any virus, but it remains your responsibility to ensure that viruses do not adversely affect you. Cancer Research UK Registered in England and Wales Company Registered Number: 4325234. Registered Charity Number: 1089464 and Scotland SC041666 Registered Office Address: Angel Building, 407 St John Street, London EC1V 4AD.
participants (2)
-
Anne Pajon -
Nate Coraor