Fwd: Map with BWA results in correpted SAM file
Hey Folks, Is there really nobody that can help Geert and me? Thats quite important to me right now. This is obviously not something specific to me, as Geert has the exact same error. I meanwhile tried to replace the id with "1" but it still doesnt work. Best Moritz ______________________________ Von: galaxy-dev-bounces@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam, Berlin, Bern, Rom, Stockholm, Wien An: galaxy-dev@lists.bx.psu.edu Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file to add on this : we have similar issues (sam-to-bam conversion fails with similar errors). it seems to be related to the BWA output getting messed up, with (part of) columns missing or duplicated on some lines. I have not found a systematic pattern in the errors, they seem to happen rather random. On 08/08/2013 05:06 PM, Moritz Juchler wrote: Dear Galaxy Community, I have a local instance and installed 0.5.9-r16 BWA and the toolshed wrapper. The mapping is successful. I then use the Filter Sam Tool on the sam file from the alignment, but it spits out this error: Dataset 26: Filter SAM on data 24 Tool execution generated the following error message: Traceback (most recent call last): File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 148, in <module> if __name__ == "__main__": main() File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 137, in main flags = int( fields[flag_col] ) ValueError: invalid literal for int() with base 10: 'RG:Z:lane712s006433' I have the same workflow online and did the exact same steps on the same fastq files. Is there anything I am missing? Is there any information I can provide to answer this question? Best Moritz ___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandeweyer@ua.ac.be<mailto:geert.vandeweyer@ua.ac.be> http://ua.ac.be/cognitivegenetics http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
Hi Moritz, do you installed bwa through the toolshed or manually? Cheers, Bjoern
Hey Folks,
Is there really nobody that can help Geert and me? Thats quite important to me right now. This is obviously not something specific to me, as Geert has the exact same error. I meanwhile tried to replace the id with "1" but it still doesnt work.
Best Moritz
______________________________ Von: galaxy-dev-bounces@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam, Berlin, Bern, Rom, Stockholm, Wien An: galaxy-dev@lists.bx.psu.edu Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file
to add on this :
we have similar issues (sam-to-bam conversion fails with similar errors). it seems to be related to the BWA output getting messed up, with (part of) columns missing or duplicated on some lines.
I have not found a systematic pattern in the errors, they seem to happen rather random.
On 08/08/2013 05:06 PM, Moritz Juchler wrote: Dear Galaxy Community,
I have a local instance and installed 0.5.9-r16 BWA and the toolshed wrapper. The mapping is successful. I then use the Filter Sam Tool on the sam file from the alignment, but it spits out this error:
Dataset 26: Filter SAM on data 24
Tool execution generated the following error message:
Traceback (most recent call last): File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 148, in <module> if __name__ == "__main__": main()
File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 137, in main flags = int( fields[flag_col] ) ValueError: invalid literal for int() with base 10: 'RG:Z:lane712s006433'
I have the same workflow online and did the exact same steps on the same fastq files. Is there anything I am missing? Is there any information I can provide to answer this question?
Best Moritz
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
--
Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandeweyer@ua.ac.be<mailto:geert.vandeweyer@ua.ac.be> http://ua.ac.be/cognitivegenetics http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Through toolshed. On 14 August 2013 12:50, Bjoern Gruening <bjoern.gruening@gmail.com> wrote:
Hi Moritz,
do you installed bwa through the toolshed or manually?
Cheers, Bjoern
Hey Folks,
Is there really nobody that can help Geert and me? Thats quite important to me right now. This is obviously not something specific to me, as Geert has the exact same error. I meanwhile tried to replace the id with "1" but it still doesnt work.
Best Moritz
______________________________ Von: galaxy-dev-bounces@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam, Berlin, Bern, Rom, Stockholm, Wien An: galaxy-dev@lists.bx.psu.edu Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file
to add on this :
we have similar issues (sam-to-bam conversion fails with similar errors). it seems to be related to the BWA output getting messed up, with (part of) columns missing or duplicated on some lines.
I have not found a systematic pattern in the errors, they seem to happen rather random.
On 08/08/2013 05:06 PM, Moritz Juchler wrote: Dear Galaxy Community,
I have a local instance and installed 0.5.9-r16 BWA and the toolshed wrapper. The mapping is successful. I then use the Filter Sam Tool on the sam file from the alignment, but it spits out this error:
Dataset 26: Filter SAM on data 24
Tool execution generated the following error message:
Traceback (most recent call last): File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 148, in <module> if __name__ == "__main__": main()
File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 137, in main flags = int( fields[flag_col] ) ValueError: invalid literal for int() with base 10: 'RG:Z:lane712s006433'
I have the same workflow online and did the exact same steps on the same fastq files. Is there anything I am missing? Is there any information I can provide to answer this question?
Best Moritz
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
--
Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandeweyer@ua.ac.be<mailto:geert.vandeweyer@ua.ac.be> http://ua.ac.be/cognitivegenetics http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Also through toolshed, version 0.5.9-r16. An example error on our part is (SamToBam): Error extracting alignments from (/galaxy/galaxy-dist/database/files/067/dataset_67090.dat), [samopen] SAM header is present: 25 sequences. Parse error at line 261924: sequence and quality are inconsistent Aborted That line in the sam does show sequence/qual inconsistency in length: HWI-1KL167:27:D1NADACXX:4:2315:10415:96156 0 chr1 152187281 0 99M * 0 0 CTGGAAGACTGACCTGTGCTAGATCCCTCCTGGTCAAAGGTTGATGACTGTCCTGATGTAGAACCATGCTGTCCTTGGCTACAGAAGTGCCCTGAGCCA BBBFFBFFFFFFFFIFFFBFFBBFBFFFFFBBB XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:33A65 fastq file fed to BWA holds the correct info: @HWI-1KL167:27:D1NADACXX:4:2315:10415:96156 1:N:0:GTGGCC CTGGAAGACTGACCTGTGCTAGATCCCTCCTGGTCAAAGGTTGATGACTGTCCTGATGTAGAACCATGCTGTCCTTGGCTACAGAAGTGCCCTGAGCCA + BBBFFBFFFFFFFFIFFFIIIIIFIIIIIIFFFIIIIFIIFFFFIIIIFFIIIFFFFFFIIIIBFFBFIFFFFBFBBBFFFFFFFFFB<BBFFFB<<B< Best, Geert ________________________________________ Van: galaxy-dev-bounces@lists.bx.psu.edu [galaxy-dev-bounces@lists.bx.psu.edu] namens Moritz Juchler [juchler@stud.uni-heidelberg.de] Verzonden: woensdag 14 augustus 2013 12:59 Aan: Bjoern Gruening CC: galaxy-dev@bx.psu.edu Onderwerp: Re: [galaxy-dev] Fwd: Map with BWA results in correpted SAM file Through toolshed. On 14 August 2013 12:50, Bjoern Gruening <bjoern.gruening@gmail.com<mailto:bjoern.gruening@gmail.com>> wrote: Hi Moritz, do you installed bwa through the toolshed or manually? Cheers, Bjoern
Hey Folks,
Is there really nobody that can help Geert and me? Thats quite important to me right now. This is obviously not something specific to me, as Geert has the exact same error. I meanwhile tried to replace the id with "1" but it still doesnt work.
Best Moritz
______________________________ Von: galaxy-dev-bounces@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam, Berlin, Bern, Rom, Stockholm, Wien An: galaxy-dev@lists.bx.psu.edu<mailto:galaxy-dev@lists.bx.psu.edu> Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file
to add on this :
we have similar issues (sam-to-bam conversion fails with similar errors). it seems to be related to the BWA output getting messed up, with (part of) columns missing or duplicated on some lines.
I have not found a systematic pattern in the errors, they seem to happen rather random.
On 08/08/2013 05:06 PM, Moritz Juchler wrote: Dear Galaxy Community,
I have a local instance and installed 0.5.9-r16 BWA and the toolshed wrapper. The mapping is successful. I then use the Filter Sam Tool on the sam file from the alignment, but it spits out this error:
Dataset 26: Filter SAM on data 24
Tool execution generated the following error message:
Traceback (most recent call last): File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 148, in <module> if __name__ == "__main__": main()
File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py", line 137, in main flags = int( fields[flag_col] ) ValueError: invalid literal for int() with base 10: 'RG:Z:lane712s006433'
I have the same workflow online and did the exact same steps on the same fastq files. Is there anything I am missing? Is there any information I can provide to answer this question?
Best Moritz
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
--
Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandeweyer@ua.ac.be<mailto:geert.vandeweyer@ua.ac.be><mailto:geert.vandeweyer@ua.ac.be<mailto:geert.vandeweyer@ua.ac.be>> http://ua.ac.be/cognitivegenetics http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
participants (3)
-
Bjoern Gruening -
Moritz Juchler -
Vandeweyer Geert