[hg] galaxy 3440: Update Combine FASTA and QUAL tool to allow th...

25 Feb 2010

details:   http://www.bx.psu.edu/hg/galaxy/rev/674aaee19991
changeset: 3440:674aaee19991
user:      Dan Blankenberg <dan@bx.psu.edu>
date:      Wed Feb 24 16:50:06 2010 -0500
description:
Update Combine FASTA and QUAL tool to allow the quality score file to be optional.

When not provided, the output will be fastqsanger or fastqsolid (when a csfasta is provided) with each quality score being the maximal allowed value (93).

diffstat:

 lib/galaxy_utils/sequence/fasta.py                         |    2 +
 lib/galaxy_utils/sequence/fastq.py                         |   25 +
 test-data/fastq_combiner_no_qual_ascii_out_1.fastqsolid    |  576 +++++++++++++
 test-data/fastq_combiner_no_qual_decimal_out_1.fastqsanger |   12 +
 tools/fastq/fastq_combiner.py                              |   11 +-
 tools/fastq/fastq_combiner.xml                             |   16 +-
 6 files changed, 637 insertions(+), 5 deletions(-)

diffs (725 lines):

diff -r 46849d69d7e6 -r 674aaee19991 lib/galaxy_utils/sequence/fasta.py

--- a/lib/galaxy_utils/sequence/fasta.py	Wed Feb 24 16:48:22 2010 -0500
+++ b/lib/galaxy_utils/sequence/fasta.py	Wed Feb 24 16:50:06 2010 -0500
@@ -53,6 +53,8 @@
     def close( self ):
         return self.file.close()
     def get( self, sequence_id ):
+        if not isinstance( sequence_id, basestring ):
+            sequence_id = sequence_id.identifier
         rval = None
         if sequence_id in self.offset_dict:
             initial_offset = self.file.tell()
diff -r 46849d69d7e6 -r 674aaee19991 lib/galaxy_utils/sequence/fastq.py
--- a/lib/galaxy_utils/sequence/fastq.py	Wed Feb 24 16:48:22 2010 -0500
+++ b/lib/galaxy_utils/sequence/fastq.py	Wed Feb 24 16:50:06 2010 -0500
@@ -3,6 +3,7 @@
 import string
 import transform
 from sequence import SequencingRead
+from fasta import fastaSequence
 
 class fastqSequencingRead( SequencingRead ):
     format = 'sanger' #sanger is default
@@ -456,6 +457,8 @@
     def close( self ):
         return self.file.close()
     def get( self, sequence_id ):
+        if not isinstance( sequence_id, basestring ):
+            sequence_id = sequence_id.identifier
         rval = None
         if sequence_id in self.offset_dict:
             initial_offset = self.file.tell()
@@ -593,3 +596,25 @@
         fastq_read.sequence = fasta_seq.sequence
         fastq_read.quality = quality_seq.sequence
         return fastq_read
+
+class fastqFakeFastaScoreReader( object ):
+    def __init__( self, format = 'sanger', quality_encoding = None ):
+        self.fastq_read = fastqSequencingRead.get_class_by_format( format )()
+        if quality_encoding != 'decimal':
+            quality_encoding = 'ascii'
+        self.quality_encoding = quality_encoding
+    def close( self ):
+        return #nothing to close
+    def get( self, sequence ):
+        assert isinstance( sequence, fastaSequence ), 'fastqFakeFastaScoreReader requires a fastaSequence object as the parameter'
+        #add sequence to fastq_read, then get_sequence(), color space adapters do not have quality score values
+        self.fastq_read.sequence = sequence.sequence
+        new_sequence = fastaSequence()
+        new_sequence.identifier = sequence.identifier
+        if self.quality_encoding == 'ascii':
+            new_sequence.sequence = chr( self.fastq_read.ascii_max ) * len( self.fastq_read.get_sequence() )
+        else:
+            new_sequence.sequence = ( "%i " % self.fastq_read.quality_max ) * len( self.fastq_read.get_sequence() )
+        return new_sequence
+    def has_data( self ):
+        return '' #No actual data exist, none can be remaining
diff -r 46849d69d7e6 -r 674aaee19991 test-data/fastq_combiner_no_qual_ascii_out_1.fastqsolid
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_combiner_no_qual_ascii_out_1.fastqsolid	Wed Feb 24 16:50:06 2010 -0500
@@ -0,0 +1,576 @@
+@1831_573_1004_F3
+T00030133312212111300011021310132222
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1050_F3
+T03330322230322112131010221102122113
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1067_F3
+T00023032023103330112220321200200002
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1219_F3
+T11211130300300301021212330201121310
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1242_F3
+T02132003121011302100130302112221121
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1333_F3
+T00200312330110101013212313222303112
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1362_F3
+T21203131001102231121211101111321131
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1448_F3
+T23101211223113320132212331313312022
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1490_F3
+T31312310323301210002210123101021011
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1523_F3
+T10322001220012223202202222001230222
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1578_F3
+T21202302100010020121100311022120111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1647_F3
+T10222233301013033120132223202022123
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1684_F3
+T13310013212312012302121010221231123
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1769_F3
+T33220123030232212032021032302233131
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1853_F3
+T11000012111222211310103212122102331
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1943_F3
+T20300123032210232001222122001132111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_573_1977_F3
+T22212302221310332321002303112011311
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_109_F3
+T13122332123301331032220222133301033
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_148_F3
+T01200113123030012202302312200010231
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_185_F3
+T21123333211302300321312212102123121
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_243_F3
+T30221011230013102201033131203302330
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_257_F3
+T00301133110002100302003000000102301
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_293_F3
+T23213210003000103010211331300320130
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_389_F3
+T21032213032101122333230212301312020
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_575_F3
+T33313322100212102033032123311211302
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_592_F3
+T33103330110123102223122023103310330
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_617_F3
+T20021031221222021210021322200223211
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_725_F3
+T32010020322130330333010031120313210
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_734_F3
+T31132301200020012302210322213222222
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_824_F3
+T30212100033032123311211302122020013
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_959_F3
+T11212130220131221111002020123311211
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1062_F3
+T30112230030300221001032033012211012
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1092_F3
+T02013221200031031212200000111130310
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1103_F3
+T20313113203302010303131123021310121
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1116_F3
+T21011310123202303021021112021231011
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1194_F3
+T23303101033322220312200222013013312
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1204_F3
+T21330132231321322010303023221203200
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1306_F3
+T10332133020311023221213100301001220
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1387_F3
+T12301331310032132101301303230121111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1431_F3
+T12011023331022213001123111301312011
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1560_F3
+T32212313302203320020222113111011111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1591_F3
+T23202101330322130221230222201123202
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1624_F3
+T20122200222132200313011102302210332
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1826_F3
+T13012312120112021233030302313201111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1903_F3
+T30232100103132133321330310210101221
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_574_1961_F3
+T02333101331223303300200011100032200
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_54_F3
+T13331330322230200102132110132013200
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_80_F3
+T33133322233322221003332230323312313
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_192_F3
+T30013012111133003301010212123302011
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_197_F3
+T33312113010133020301131330001310032
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_223_F3
+T10121010002202131221210302100121020
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_420_F3
+T31110103220000101310112112001020212
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_434_F3
+T30312132120223101113223301211113311
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_444_F3
+T33022120112320220100202132332113320
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_459_F3
+T31330310210101223330110231120131100
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_506_F3
+T31210200111210121332321310110132301
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_569_F3
+T10210201321323001012232322323002203
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_622_F3
+T01100031122111023002323113231210111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_644_F3
+T11332003221203131231202200030110130
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_663_F3
+T32210013303112103322311101322021210
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_681_F3
+T23131132033020103031013233200101021
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_711_F3
+T03032331231101231020121210002332121
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_730_F3
+T31010102200110302123032330331011111
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_904_F3
+T20111213300020123200333321131121211
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_938_F3
+T13103102220022130222233301013033120
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_970_F3
+T23201311301023133303023011202220221
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_991_F3
+T33312212031111111012212120321121210
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1138_F3
+T23320002011320012120333103233301321
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1157_F3
+T13121323330203331222022230133102321
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1180_F3
+T32003310122102323303101123331133110
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1283_F3
+T02232200301300220130032321323131333
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1302_F3
+T01201303312333123130200123201013021
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1310_F3
+T31332131312021303211310220101211133
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1321_F3
+T11001010233200122122022023000203212
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1373_F3
+T21213011223311001221321132013121220
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1419_F3
+T33222200303001021230212332001013020
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1436_F3
+T13210313021212303321202113301220331
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1442_F3
+T33132010022331132101132123132020222
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1454_F3
+T11131130011012021120222231313211113
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1500_F3
+T11010000223111301132313011130103021
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1535_F3
+T21312012030320112110211013300131121
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1724_F3
+T33123002323300220213232301000010010
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1829_F3
+T21033321320111321230233302313101021
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1898_F3
+T31330110303103131001110300102101330
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_575_1964_F3
+T22010201103202213200201301300232123
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_32_F3
+T13012100120333032211330300332022110
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_74_F3
+T30103313210232220102021223012112100
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_86_F3
+T10320000121033022010011030032211310
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_89_F3
+T02132333203332020020220033002121120
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_266_F3
+T30322223101312011300311121221333223
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_327_F3
+T22112331301313021321001332120332130
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_331_F3
+T32012133301311223023011232112333030
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_387_F3
+T00101211032031120300200222001230022
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_406_F3
+T00223133010210122221320212103132011
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_449_F3
+T31312001121222231100020132132100220
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_519_F3
+T03011321130130133213131202130321131
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_603_F3
+T21003032313302312320131221001330311
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_655_F3
+T02001023130302322122200313123123102
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_677_F3
+T13330131023320301031013230210103022
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_718_F3
+T31232113331022231333313223132231213
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_722_F3
+T31230320322120231333030031100313200
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_754_F3
+T30221231132103120112331303112133020
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_815_F3
+T23022113203032010120310102321001031
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_882_F3
+T13230020122320223230022031020110122
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_898_F3
+T10230132312121033222231132231233213
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_923_F3
+T21322010320202013210121223010123122
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_930_F3
+T21322103230123110323102012021020013
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1019_F3
+T22032121213231032210312001103122312
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1068_F3
+T00020232013101330112220321203220211
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1131_F3
+T10233122200222132200313011102302210
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1168_F3
+T31013300131121323122002113301002010
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1207_F3
+T21001132013000122220301213221213010
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1289_F3
+T03021210023110200323310302013121203
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1329_F3
+T01100302102020113003022000120002100
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1367_F3
+T12231310311233110031222013332011023
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1416_F3
+T33021233100123120313103133211203221
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1461_F3
+T32022221221112233100210223002100100
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1605_F3
+T30232100103132133321330310210101221
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1664_F3
+T31212101001312110320301201002011120
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1671_F3
+T22313332300211322113223102231322313
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1729_F3
+T11233312313010012320101302101023030
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1880_F3
+T13032121323320213301001310130212003
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1982_F3
+T00032312310201201333221212000011030
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_1987_F3
+T30022313313231221213220132001011320
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_2014_F3
+T31123201010100321122111102113021003
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_576_2028_F3
+T20131211210311112023201213120201100
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_40_F3
+T11111212330120012020200031313303003
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_119_F3
+T33111010021103320103213121313000102
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_133_F3
+T33213323012231300122223032223331322
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_255_F3
+T00332022110020300332022020202002232
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_281_F3
+T03032301231212301013112222111210000
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_288_F3
+T01031120221303100221230021013201130
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_322_F3
+T12003213220230103303201000130312202
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_362_F3
+T31203302330110131230331210121110220
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_382_F3
+T32312123033111120321303230201332100
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_464_F3
+T13020221011130013102221333131203302
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_488_F3
+T13200302330322110200323132101120301
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_511_F3
+T32232133031023313331312220133230333
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_545_F3
+T00112131333222303222210031322103233
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_559_F3
+T32321101303233120102011130022122002
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_562_F3
+T32331101301233110121000220031120031
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_637_F3
+T22113312122202103031023120301031110
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_641_F3
+T13031301101121223221212020032131113
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@1831_577_692_F3
+T01122320200330103121202301211100220
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
diff -r 46849d69d7e6 -r 674aaee19991 test-data/fastq_combiner_no_qual_decimal_out_1.fastqsanger
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_combiner_no_qual_decimal_out_1.fastqsanger	Wed Feb 24 16:50:06 2010 -0500
@@ -0,0 +1,12 @@
+@SRR014849.50939 EIXKN4201BA2EC length=135
+GAAATTTCAGGGCCACCTTTTTTTTGATAGAATAATGGAGAAAATTAAAAGCTGTACATATACCAATGAACAATAAATCAATACATAAAAAAGGAGAAGTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGG
++
+93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 
+@SRR014849.110027 EIXKN4201APUB0 length=131
+CTTCAAATGATTCCGGGACTGTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTTCGGTTCCAACTCGCCGTCCGAATAATCCGTTCAAAATCTTGGCCTGTCAAAACGACTTTACGACCAGAACGATCCG
++
+93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 
+@SRR014849.203935 EIXKN4201B4HU6 length=144
+AACCCGTCCCATCAAAGATTTTGGTTGGAACCCGAAAGGGTTTTGAATTCAAACCCCTTTCGGTTCCAACTATTCAATTGTTTAACTTTTTTTAAATTGATGGTCTGTTGGACCATTTGTAATAATCCCCATCGGAATTTCTTT
++
+93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 
diff -r 46849d69d7e6 -r 674aaee19991 tools/fastq/fastq_combiner.py
--- a/tools/fastq/fastq_combiner.py	Wed Feb 24 16:48:22 2010 -0500
+++ b/tools/fastq/fastq_combiner.py	Wed Feb 24 16:50:06 2010 -0500
@@ -1,6 +1,6 @@
 #Dan Blankenberg
 import sys, os, shutil
-from galaxy_utils.sequence.fastq import fastqWriter, fastqSequencingRead, fastqCombiner
+from galaxy_utils.sequence.fastq import fastqWriter, fastqSequencingRead, fastqCombiner, fastqFakeFastaScoreReader
 from galaxy_utils.sequence.fasta import fastaReader, fastaNamedReader
 
 def main():
@@ -23,15 +23,18 @@
         format = 'illumina'
     
     out = fastqWriter( open( output_filename, 'wb' ), format = format, force_quality_encoding = force_quality_encoding )
-    qual_input = fastaNamedReader( open( qual_filename, 'rb' )  )
+    if qual_filename == 'None':
+        qual_input = fastqFakeFastaScoreReader( format, quality_encoding = force_quality_encoding )
+    else:
+        qual_input = fastaNamedReader( open( qual_filename, 'rb' )  )
+    
     fastq_combiner = fastqCombiner( format )
     i = None
     skip_count = 0
     for i, sequence in enumerate( fastaReader( open( fasta_filename, 'rb' ) ) ):
-        quality = qual_input.get( sequence.identifier )
+        quality = qual_input.get( sequence )
         if quality:
             fastq_read = fastq_combiner.combine( sequence, quality )
-            #Should we check that fastq read is valid? for now, assume groomer will be used to verify
             out.write( fastq_read )
         else:
             skip_count += 1
diff -r 46849d69d7e6 -r 674aaee19991 tools/fastq/fastq_combiner.xml
--- a/tools/fastq/fastq_combiner.xml	Wed Feb 24 16:48:22 2010 -0500
+++ b/tools/fastq/fastq_combiner.xml	Wed Feb 24 16:50:06 2010 -0500
@@ -3,7 +3,7 @@
   <command interpreter="python">fastq_combiner.py '$fasta_file' '${fasta_file.extension}' '$qual_file' '${qual_file.extension}' '$output_file' '$force_quality_encoding'</command>
   <inputs>
     <param name="fasta_file" type="data" format="fasta,csfasta" label="FASTA File" />
-    <param name="qual_file" type="data" format="qual" label="Quality Score File" />
+    <param name="qual_file" type="data" format="qual" label="Quality Score File" optional="True" />
     <param name="force_quality_encoding" type="select" label="Force Quality Score encoding">
       <option value="None">Use Source Encoding</option>
       <option value="ascii" selected="True">ASCII</option>
@@ -45,11 +45,25 @@
       <param name="force_quality_encoding" value="decimal" />
       <output name="output_file" file="wrapping_as_sanger_decimal.fastqsanger" />
     </test>
+    <test>
+      <param name="fasta_file" value="fastq_combiner_in_1.fasta" ftype="fasta" />
+      <param name="qual_file" />
+      <param name="force_quality_encoding" value="decimal" />
+      <output name="output_file" file="fastq_combiner_no_qual_decimal_out_1.fastqsanger" />
+    </test>
+    <test>
+      <param name="fasta_file" value="s2fq_phiX.csfasta" ftype="csfasta" />
+      <param name="qual_file" />
+      <param name="force_quality_encoding" value="ascii" />
+      <output name="output_file" file="fastq_combiner_no_qual_ascii_out_1.fastqsolid" />
+    </test>
   </tests>
   <help>
 **What it does**
 
 This tool joins a FASTA file to a Quality Score file, creating a single FASTQ block for each read.
 
+Specifying a set of quality scores is optional; when not provided, the output will be fastqsanger or fastqsolid (when a csfasta is provided) with each quality score being the maximal allowed value (93).
+
   </help>
 </tool>

    

Greg Von Kuster

tags

participants (1)