Hi, I am trying to join two groomed fastq files from a paired-end Illumina read using the fastq joiner tool. The drop-down menus correctly identify the groomed fastq files, but after cranking for a few minutes the tool produces empty output: "FASTQ joiner on data 5 and data 4emptyformat: fastqsanger, database: ?Info: There were 3497909 known sequence reads not utilized.Joined 0 of 3497909 read pairs (0.00%)." The files have the same number of reads (3497909), reads have the same number of bases (102), and the joiner tool doesn't have any options (other than choosing the two files to join). I have tried this with Sanger and with Illumina 1.3+ quality scores, and in both (left-right) orientations. I've pasted the beginnings of the two files below my signature in case this is useful for diagnosing the problem. Can anyone tell me what I'm doing wrong? Thanks, -- Matthew D. Herron, PhD Department of Zoology University of British Columbia X.princeps@gmail.com http://www.eebweb.arizona.edu/grads/mherron/ Sample of read 1: @HWI-ST765:83:D091AACXX:1:1101:1202:2130 1:N:0:ACTTGA TTATTCCGTTTACCTTCACGCTGTTATGGCTCTCGGTGTTCGGCAATAGCGCGCTGTATGAAATTATCCACGGCGGCGCGGCATTTGCCGAGGAAGCGATG + CCCFFFFFHHHHHJJJJJJJJJJJJIJIJJJIEHII?FGIIJJJJJJJIJJJHFFDDEEEDEDDDDEDDDDDDDDDDDDDDDDDDD@CCD3<BDD@DDDBD Sample of read 2: @HWI-ST765:83:D091AACXX:1:1101:1202:2130 2:N:0:ACTTGA ATTCCCCAGCACCAGCGCCCCGGAGTCCGCCGAGGTCACATAAAACAGCAGGCCAGTAATGGTGGCGACGGAGGCGCTAAAGGTAAACGCCGGATACTGCG + CCCFFFFFFGHHHJJJJJJJJJIJIFHIIJJJJIG:BEFFFFEEEDDCBDDDDDDD@CDDDCACDDDBDDDDDDBDDDDDDDC>@CCC@@DDDDDDDDEDB