Hi Bin, The reply given for this same question posted at seqanswers is correct, including the Tool Shed comments: http://seqanswers.com/forums/showthread.php?t=14106 To give a bit more detail, when using the public Galaxy instance at http://usegalaxy.org, the idea would be to run the "NGS: QC and manipulation -> Clip" tool with each adapter, one at a time. Each time start with the same original file and only output sequences that are clipped. Then merge at the end, if wanted, for downstream analysis. The Clip tool is sourced from the FASTX-toolkit and currently does only work for 3' adapters. You may want to contact the tool author Assaf Gordon if you have a suggestions/use cases for tool enhancements http://hannonlab.cshl.edu/fastx_toolkit/. Just so you know, there are tools that simply trim off bases, from either end, which may or may not work for needs. Please see "FASTQ Trimmer" and "Trim sequences". I also opened a bitbucket ticket to track the ideas for expanding the options for this type of function. This can be tracked at: http://bitbucket.org/galaxy/galaxy-central/issue/659/expand-adapter-sequence... Hopefully one of the available options will work out for your project, Best, Jen Galaxy team On 9/14/11 2:17 PM, Binbin You wrote:
Hi All,
In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip.
In addition, In "*What it does" it shows: * This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
So how could i do if I have the adapter sequences like this:
5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT 5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA 5' GACGGCATACGAGCTCTTCCGATCT 5' AGATCGGAAGAGCTCGTATGCCGTC
Thanks very much for any response!
Best wishes, Bin
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support