Dear Galaxy, I have some genomic intervals for the human genome and want to extract the same for the mouse.So, I used the MAF pairwise alignment tool. But, interestingly, the associated sequences are not to be found at all through the genome browser, for file that galaxy generated for me. Here are a few first alignments from the sample: ##maf version=1 a score=5002 s hg18.chr1 1820410 11 + 247249719 GGATCCAG-------ATG s mm9.chr4 769022 18 - 155630120 GAAACAAGGTGTTCCATG a score=20688 s hg18.chr1 2077163 10 + 247249719 TTTTCTTTTC s mm9.chr4 969004 10 - 155630120 CTTTCTTACC a score=15289 s hg18.chr1 2316453 90 + 247249719 CTCAGGTGAATTCCTCATGGCATCACAGCAGTGTTGAAA-----TAGGAGCAGATACG-TTACCTCCGC--TTGCCAGATAAGAAACTGGGACGCAGA s mm9.chr4 1172933 98 - 155630120 TTACAGTGAATTCTGCCTGGGATCCGTGCAGCATTGGAAATGGCTAGGGGCAGATAGGGTCACCTTCACAGTTGCTAGATAAGAAACAGGGTCGCGGA a score=20716 s hg18.chr1 2526225 31 + 247249719 CTTCCT-CTGGGCTTGGTCATCCTTCAAAGTC s mm9.chr4 1369046 32 - 155630120 CTTCCTCCTGGTCCCAACCATCTGTCAGATCC I just want the sequences from the mouse genome and extended up to 120 base pairs from the co-ordinate mentioned in the maf file. It only generates NNNNNNNNNNNNN....I was wondering how could Galaxy retrieve it, while I can't see the same in the genome browser. Kindly help. Amit.