
14 Sep
2011
14 Sep
'11
5:17 p.m.
Hi All, In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip. In addition, In "What it does" it shows: This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. So how could i do if I have the adapter sequences like this: 5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT 5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA 5' GACGGCATACGAGCTCTTCCGATCT 5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much for any response! Best wishes, Bin