 
            Hi everyone, I want to calculate GC content of transcripts in the gtf file like this: chr1 Cufflinks transcript 3 22 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; chr1 Cufflinks exon 3 10 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "1"; chr1 Cufflinks exon 13 18 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "2"; chr1 Cufflinks exon 20 22 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "3"; and the genome sequence that transcript comes from is:
chr1 GTAGCGTCTCCGACGCGGATATGACCGCACGCTGATGCTCCCAGGGATGAGAGGCGTGCG
I have to calculate GC content of the transcript after getting the sequence of the transcript. So how can I get the sequence of the transcript. In this case, it would be AGCGTCTC + ACGCGG + TAT, meaning the transcript sequence would be AGCGTCTCACGCGGTAT. Is it possible in the Galaxy?