Hi Rajarshi,

How many barcodes do you have? If just a few, then the 'Filter and Sort -> Select' tool might be a good choice. This will do about the same thing as the "grep" in the top answer at Biostar, for the same type of question: http://www.biostars.org/p/15446/

I did check the tool shed and didn't find any tools that would do this. Maybe also post a inquiry galaxy-dev@bx.psu.edu and see if someone has developed a tool that will demultiplex fastq sequences with barcodes in the identifier, but hasn't loaded it into the tool shed yet?

You could also open a request to have such a tool created (or the current barcode tool expanded): http://wiki.galaxyproject.org/Support#Trello_Issue_Board

Good luck!

Jen
Galaxy team

On 12/2/12 10:54 AM, Rajarshi Ghosh wrote:

I have lllumina sequences which are barcoded in the sequence identifier e.g.:

@FCC186GACXX:6:1101:1473:2060#TCGCAGGA/1
CTCCACGAAACCGGAAGGGTAGAAAAGTTCGGTCAACTCGTTCCTCACAATTTGCCCGATTCTCAGAAAAATTGTTTTGTGACCTCTCTC

The '#TCGCAGGA" is the barcode. As the barcode is not on the 5' or 3' end I cannot use the barcode splitter. Is there a workaround in Galaxy for this?

Thanks!

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

-- 
Jennifer Jackson
http://galaxyproject.org