Dear Galaxy

I have a problem converting Interval to GFF.

I used the tool BED-to-GFF converter.
My Interval file contains 18 coulmns:

chr1	33308998	33309020	+	cel-let-7-5p	0	chr1	33308999	255	22M	*	0	0	AGAGGAAGAAGGAAGAAAAGAA	UGAGGUAGUAGGUUGUAUAGUU	XA:i:0	MD:Z:22	NM:i:0

However my GFF output only contains 9, and it has removed the feature "cel-let-7-5p":

chr1	bed2gff	region_0	33308999	33309020	0	+	.	region_0;

Instead of region_0 I want the gene name, in this case the miRNA name. How do I do this?

Best Robin