Hello, Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like: "Substitute all Gs to Cs (except for CG dinucleotides)": Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT or like: "Count the number of CG dinucleotides" Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4 using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills? Thank you in advance! With respect, Maxim Ivanov Dept. of Physiology and Pharmacology Karolinska Institutet Stockholm, Sweden