Hi
We're a bit confused about exactly how the adaptor clipping tool works. Is there some documentation that describes how it does the clipping? In the clipping example given on the Galaxy page for "Clip adapter sequences" (the adaptor is CTGTAGGCACCATCATTATTTATATAA ):
- How large a substring of the sequence must the adaptor be in order for it to be clipped? E.g., if the sequence is ATGGACTCTG, it seems to clip the terminal CTG, but it doesn't clip if CTG appears somewhere in the middle of a sequence.
- Does it clip if, say, the middle part of the adaptor appears somewhere in the middle of a sequence, and if so, how long must it be before it clips?
Thank you,
Francisc Raul Kantor