Hello,
I am attempting to use Galaxy to calculate the mean
sequence read length and identify the range of read
lengths for my 454 data. The data has already been
divided into columns:
>HD4AU5D01BHBCQC
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC
TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics"
button, however it appears to only be for numerical
data and not sequence data. Is this tool/task
available
via Galaxy?
Thank you in advance,
Dominique Cowart
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/