Hello,
My account login is: johnsonko@ninds.nih.gov
I am a first time Galaxy user.
I have uploaded my sequences as format “fastq” into
Galaxy and would like to next use “Groomer” to output Sanger fastq
format so to go on with exploring quality via box plot, deciding on a trim length
(if any), and map to genome using bwa or bowtie.
However, I am running into a problem using “Groomer”.
I do not know what format my sequences are per setting the
required input parameter.
An example of my sequences is as follows:
@SNPSTER6_0679:1:1:1083:939#0/1
run=100908_SNPSTER6_0679_70929AAXX
NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA
+SNPSTER6_0679:1:1:1083:939#0/1
BIQQIQQQTP[[[[[VVVVQPPPPPTWWWW[[YYTTTOVV____TWVXRWPTQPQWWWWWTOOVV___V_TROOWTWTWTQWQWTTRWRO
… how to tell if you have: “Sanger”, “Solexa”,
“Illumina 1.3+”, etc.
I have tried to submit to “Groomer” different
times using these options one at a time and none return with results.
Need help please.
Also, what is the expected time for “Groomer” to
return results for a file containing 2.7 million reads.
Thank you … best,
Kory
--------------------------------------------
Kory R. Johnson, MS, PhD
Sr. Bioinformatics Scientist
www.kellygovernmentsolutions.com
Providing Contract Services For:
Bioinformatics Section,
Information Technology &
Bioinformatics Program,
Division of Intramural Research
(DIR),
National Institute of
Neurological Disorders & Stroke (NINDS),
National Institutes of Health (NIH),
Bethesda, Maryland
Mailing Address:
NINDS/NIH
Clinical Center (Building 10)
Office 5S223
9000 Rockville Pike
Bethesda, MD 20892
Contact Information:
Phone:
301-402-1956
Fax:
301-480-3563
email:
johnsonko@ninds.nih.gov
P Green Message:
Please consider the environment
before printing this e-mail. Thank you.
Important Message:
This electronic message transmission
contains information intended for the recipient only. Such that, the
information contained herein may be confidential, privaledged, or
proprietary. If you are not the intended recipient, be aware that any
disclosure, copying, distribution, or use of this information is strictly
prohibited. If you have received this electronic information in error, please
notify the sender immediately by telephone. Thank you.
--------------------------------------------