Hello!
I am fairly new to using Galaxy and have a question about the FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just recently generated from Illumina’s NGS instruments. I am aware that the first step to perform in Galaxy is FASTQ Groomer to convert the format to FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the “Input FASTQ quality scores type” box. However, if I look at the raw data reads, I notice that Line 4 (which encodes the quality values for sequence in Line 2) has values outside of the Illumina 1.3+ range (some of them fall into the Sanger format. I am enclosing the Quality Score Comparison figure along with some of the raw RNA-Seq data):
Quality Score Comparison
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
| | | | | |
33 59 64 73 104 126
S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads)
I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads)
X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw reads)
Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format
RNA-Seq raw data
@HWI-ST156_294:7:1:1058:2165:0/1
CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC
+
HHHHFGGHHHGFHHFHHEGHC<GGGEB.EE9D?DDEEEE4FFFCBB/.C=D