Hello,

I need to perform an action (or series of actions) on an 454 dataset using Galaxy, and have not been able to figure out the necessary steps, even after looking through the toolbar expressions and using custom search.
My file is a fasta and has the standard format:

>GNJQDEZ01A940A
CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC
ATGTTA
>GNJQDEZ01BJYQZ
CTGAGTCAGGTCAACAATCATAAGACATCGGCTCTCTATATTTAATATTGGT

Each of the 100,000 sequences within this file contains a specific tag, which is the first 8 nucleotides.
There are 19 tags total. I would like to identify these tags and add an identifier of the tag to the sequence name.
Therefore, if I am looking for the first tag (CTGAGTCA), the output would look like:

>GNJQDEZ01A940A_Tag1
CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC
ATGTTA

Is it possible to achieve this using Galaxy? If possible, could you kindly suggest tools to use.

Thank you in advance,
Dominique Cowart