Hi Li,

Tophat includes a custom tag 'XS' at the end of spliced read alignments which your pipeline is not aware about.

The following is taken from http://cufflinks.cbcb.umd.edu/manual.html

"Cufflinks takes a text file of SAM alignments as input. For more details on the SAM format, see the specification. The RNA-Seq read mapper TopHat produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept: 


s6.25mer.txt-913508	16	chr1 4482736 255 14M431N11M * 0 0 \
   CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:-
Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it must be present for all spliced alignment records (those with a 'N' operation in the CIGAR string)."

Kind regards,

Paul


2011/4/11 lishiyong <lishiyong@genomics.org.cn>
Hi：
I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) ，which is better for solid data mapping ,so I don't use the bowtie to map . Ｉgain the BAM file!　Now ,I want use the cufflinks to calculate the gene expression. But there is a error.
[15:08:06] Inspecting reads and determining fragment length distribution.
BAM record error: found spliced alignment without XS attribute
BAM record error: found spliced alignment without XS attribute
 the BAM file :
323_358_2010    73      chr1    343     0       45M5H   *       0       0       CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT   IIIIIIIIIII))C/1<DE''@DAHD379AID1;7BI+'7))I?3   RG:Z:20110328192522421   NH:i:0  CM:i:4  SM:i:2  CQ:Z:A=ABA<<>@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS:Z:T20023010023110230100030100230100230100030000200000
423_236_1955    81      chr1    550     0       8H42M   =       699451  698945  GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG      GF>IIII%%III))8IIII?IIII%%IIIIIIIIIIIIIIII      RG:Z:20110328192522421   NH:i:2  CM:i:5  SM:i:3  CQ:Z:9BA<AAB>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T20302222311033322303302232133302223222131122330223
298_1884_1495   113     chr1    562     0       7H43M   chr3    199392032       0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG     5AI;6:>AIIII>?I7FIEIIIIIIIIIIIIIIIIIIIIIIII      RG:Z:20110328192522421  NH:i:2  CM:i:0  SM:i:3  CQ:Z:BB@7<AB8@ABA=2;=>82:?A388.A&28(77;64.1*-/<&0:9/%3? CS:Z:T20221231112210030222231103332200330223213312222022
62_1428_1954    89      chr1    562     1       50M     *       0       0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC      *=AIII4/CII=%%I((=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII       RG:Z:20110328192522421  NH:i:0  CM:i:4  SM:i:0  CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=<??'7(;A%&849+%0:@.4* CS:Z:T13130222022123111221003022223110331222033022321331
 
I have sorted the bam file and the gtf file.
cufflinks  -G refGene_hg18.gtf -p 3 -r  human_hg18.fa -o test  test.pe.bam 
(the version of cufflinks is v0.9.2 ) 
    Who know the reason ,and what shoud I do!
best wishes!
Shiyong Li  
2011-04-11
lishiyong

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/



--
Paul Korir
www.paulkorir.com