Thank you very much for your reply!
 
I'd like to know how to add this 'xs' tag since the amount of reads mapped to genome is much less using tophat, can we just add a '+' or '-' at the end of each line?
 
 
2011-04-11

gaohuan

发件人: Ryan Golhar
发送时间: 2011-04-11  23:19:10
收件人: lishiyong
抄送: tophat.cufflinks; galaxy-user; 高欢
主题: Re: [galaxy-user] cufflinks FPKM problem
Cufflinks requires an 'xs' tag on each read in the bam file. Only tophat does this. You can write a script to add this or remap with tophat. 

How much of a difference do you see between tophat and bioscope?

Please excuse any typos -- Sent from my iPhone

On Apr 11, 2011, at 9:46 AM, lishiyong <lishiyong@genomics.org.cn> wrote:

Hi:
I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) ,which is better for solid data mapping ,so I don't use the bowtie to map . Igain the BAM file! Now ,I want use the cufflinks to calculate the gene expression. But there is a error.
[15:08:06] Inspecting reads and determining fragment length distribution.
BAM record error: found spliced alignment without XS attribute
BAM record error: found spliced alignment without XS attribute
 the BAM file :
323_358_2010    73      chr1    343     0       45M5H   *       0       0       CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT   IIIIIIIIIII))C/1<DE''@DAHD379AID1;7BI+'7))I?3   RG:Z:20110328192522421   NH:i:0  CM:i:4  SM:i:2  CQ:Z:A=ABA<<>@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS:Z:T20023010023110230100030100230100230100030000200000
423_236_1955    81      chr1    550     0       8H42M   =       699451  698945  GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG      GF>IIII%%III))8IIII?IIII%%IIIIIIIIIIIIIIII      RG:Z:20110328192522421   NH:i:2  CM:i:5  SM:i:3  CQ:Z:9BA<AAB>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T20302222311033322303302232133302223222131122330223
298_1884_1495   113     chr1    562     0       7H43M   chr3    199392032       0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG     5AI;6:>AIIII>?I7FIEIIIIIIIIIIIIIIIIIIIIIIII      RG:Z:20110328192522421  NH:i:2  CM:i:0  SM:i:3  CQ:Z:BB@7<AB8@ABA=2;=>82:?A388.A&28(77;64.1*-/<&0:9/%3? CS:Z:T20221231112210030222231103332200330223213312222022
62_1428_1954    89      chr1    562     1       50M     *       0       0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC      *=AIII4/CII=%%I((=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII       RG:Z:20110328192522421  NH:i:0  CM:i:4  SM:i:0  CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=<??'7(;A%&849+%0:@.4* CS:Z:T13130222022123111221003022223110331222033022321331
 
I have sorted the bam file and the gtf file.
cufflinks  -G refGene_hg18.gtf -p 3 -r  human_hg18.fa -o test  test.pe.bam 
(the version of cufflinks is v0.9.2 ) 
    Who know the reason ,and what shoud I do!
best wishes!
Shiyong Li  
2011-04-11

lishiyong
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/