Hello,


I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been divided into columns:

>HD4AU5D01BHBCQC    TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC    TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT


I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available
via Galaxy?

Thank you in advance,


Dominique Cowart