Hello,
I am attempting to use Galaxy to calculate the mean
sequence read length and identify the range of read
lengths for my 454 data. The data has already been
divided into columns:
>HD4AU5D01BHBCQC
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC
TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button,
however it appears to only be for numerical data and not
sequence data. Is this tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart