Dear Galaxy Team and users,

I have some 454 reads that I would like to map against a contig assembly using LASTZ.  I have already mapped the reads uploaded in fasta format against the assembly but, as mapping the reads in fasta ignores the base qualities that would be present in a fastq file, I am concerned that I might need the base quality information that may be crucial in deciding on ‘real’ SNPs later down the line.  So, as LASTZ apparently recognises fastq (*see below), I converted the reads to fastq using the ‘Combine fasta and qual’ tool in Galaxy and I am now currently trying to map the reads to the assembly.  However, Galaxy would not recognise the fastq reads in the LASTZ input page.  So I tried to fool it by changing the data type of the fastq to fasta using the ‘Edit attributes’ function of the history.  This kept the fastq info but allowed Galaxy to recognise the file as input for LASTZ.   However, this mapping has been running for almost 24 hours now and so I am concerned that there is an error.

Is anyone able offer any help with why Galaxy does not recognise the reads in fastq format prior to mapping with LASTZ? 

Here are what the first two reads look like in fastq format:

@GIQ547K01A7QJK length=76 xy=0381_0142 region=1 run=R_2010_06_11_16_16_09_

GCTTCGTGTGCGACGACACTCGTCATCGACAACGCAAGACTGGCGCTATCGCAATTGGACACACAACATGTGACCG

+

27 19 17 17 18 19 11 14 14 17 19 17 22 17 17 14 14 14 17 19 17 19 17 17 19 19 25 25 22 17 12 13 14 19 21 21 21 27 21 19 19 17 17 19 17 24 25 22 20 22 22 17 16 16 12 12 12 12 19 22 17 17 17 20 20 22 27 21 25 22 20 20 22 21 16 12

@GIQ547K01AE4BG length=40 xy=0055_0266 region=1 run=R_2010_06_11_16_16_09_

GTGACTAGATACATGCAATCAATTGTCCATGTCATTCGAG

+

27 23 23 19 19 19 18 19 21 19 18 19 18 25 27 27 26 26 27 27 27 27 27 19 19 18 19 19 27 27 25 24 25 25 21 21 22 22 22 18

* Input formats (copied from the LASTZ input page in Galaxy)

LASTZ accepts reference and reads in FASTA format. However, because Galaxy supports implicit format conversion the tool will recognize fastq and other method specific formats.

With thanks,

Chris