Hi Dominique,
Id use the original fasta file and input it into the 'Fasta Manipulation > Compute Sequence Length' tool
Then, using the output, run the 'Statistics > Summary Statistics for any numerical column' tool on c2.
That will give you all the info youre after.
Cheers,
Graham

Dr. Graham Etherington
Bioinformatics Support Officer,
The Sainsbury Laboratory,
Norwich Research Park, 
Norwich NR4 7UH.
UK
Tel: +44 (0)1603 450601
Twitter: @bioinformatiks

From: Dominique Cowart <dac330@gmail.com>
Date: Friday, 23 May 2014 12:29
To: "galaxy-user@bx.psu.edu" <galaxy-user@bx.psu.edu>
Subject: [galaxy-user] Summary Statistics


Hello,


I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been divided into columns:

>HD4AU5D01BHBCQC    TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC    TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT


I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available
via Galaxy?

Thank you in advance,


Dominique Cowart