Hi£º
I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) £¬which is better for solid data mapping ,so I don't use the bowtie to map . £Égain the BAM file!¡¡Now ,I want use the cufflinks to calculate the gene expression. But there is a error.
[15:08:06] Inspecting reads and determining fragment length distribution.
BAM record error: found spliced alignment without XS attribute
BAM record error: found spliced alignment without XS attribute
 the BAM file :
323_358_2010    73      chr1    343     0       45M5H   *       0       0       CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT   IIIIIIIIIII))C/1<DE''@DAHD379AID1;7BI+'7))I?3   RG:Z:20110328192522421   NH:i:0  CM:i:4  SM:i:2  CQ:Z:A=ABA<<>@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS:Z:T20023010023110230100030100230100230100030000200000
423_236_1955    81      chr1    550     0       8H42M   =       699451  698945  GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG      GF>IIII%%III))8IIII?IIII%%IIIIIIIIIIIIIIII      RG:Z:20110328192522421   NH:i:2  CM:i:5  SM:i:3  CQ:Z:9BA<AAB>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T20302222311033322303302232133302223222131122330223
298_1884_1495   113     chr1    562     0       7H43M   chr3    199392032       0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG     5AI;6:>AIIII>?I7FIEIIIIIIIIIIIIIIIIIIIIIIII      RG:Z:20110328192522421  NH:i:2  CM:i:0  SM:i:3  CQ:Z:BB@7<AB8@ABA=2;=>82:?A388.A&28(77;64.1*-/<&0:9/%3? CS:Z:T20221231112210030222231103332200330223213312222022
62_1428_1954    89      chr1    562     1       50M     *       0       0       ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC      *=AIII4/CII=%%I((=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII       RG:Z:20110328192522421  NH:i:0  CM:i:4  SM:i:0  CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=<??'7(;A%&849+%0:@.4* CS:Z:T13130222022123111221003022223110331222033022321331
 
I have sorted the bam file and the gtf file.
cufflinks  -G refGene_hg18.gtf -p 3 -r  human_hg18.fa -o test  test.pe.bam 
(the version of cufflinks is v0.9.2 ) 
    Who know the reason ,and what shoud I do!
best wishes!
Shiyong Li  
2011-04-11

lishiyong