Hello Dominique,

Would the tool 'NGS: QC and manipulation -> Barcode Splitter' meet your needs? Please see the tool's help for usage.

Another option is to first covert the file to tabular with 'FASTA manipulation ->FASTA-to-Tabular', then use the 'Filter and Sort -> Filter' tool. The match criteria would look something like: c2=='ATGC' . Once done, convert back to fasta with 'FASTA manipulation -> Tabular-to-FASTA'.

Hopefully one of these methods will work out for you,

Jen
Galaxy team

On 12/14/12 11:10 AM, D. A. Cowart wrote:

Hello,

I would like to use Galaxy to divide a very large Ilumnia fasta file (~3GB) into separate fasta files. Is this possible on Galaxy? Here is an example of the reads:
>HWI-ST156:535:C10GLACXX:8:1101:1195:1080 1:N:0:CGGTTGT
AAATAGAATATCACATTAAAATCACAAGCAGGACAGTGTGTGTAAAAGAAATCTTTTGTGAATTCAACGTTTATCAATTAGANNNNACGCCTACGTGTAG

>HWI-ST156:535:C10GLACXX:8:1101:1210:1102 1:N:0:CGGTTGT
ATTTATCATAACAACTTAAATCAGTCAGTGGATTTCTGTCGGTCCGGTTAGCTCGGTTGGTAAAGGCGTTTGTTCGATCGTCTGTATTTTGCAATCGGGC
I have tried the "Filter and Sort" option to try and select sequences just by a beginning sequence (ATGC, for example) to separate these sequences into a specific file, but I have been unsuccessful in this.

Thank you,

Dominique
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

-- 
Jennifer Jackson
http://galaxyproject.org