Dear sir, I need a up-to-date file of UCSC 17-way multi-alignment for the upstream 1000 bp of Refseq. UCSC has a download (http://hgdownload.cse.ucsc.edu/goldenPath/hg18/multiz17way/upstream1000.m... ). This file begin with human refseq ID and do multiz for the upstream 1000bp of each refseq. It is exactly match my requirement, but it is a little old. It was build at 2007. I need a new version of such a file. I have asked UCSC group, they told me that I can't get such a file using UCSC table. But they told I can get it from your Galaxy. I tried some times but failed. Can you told me how to get a 17-way (or just human and mouse) alignment file for upstream 1000bp of all refseq? Thanks very much. Anyuan Guo ================ Anyuan Guo Ph.D. Postdoc Fellow Virginia Institute for Psychiatric and Behavioral Genetics Virginia Commonwealth University P.O. Box 980126 Richmond, VA 23298-0126, USA Email: aguo(a)vcu.edu Brooke Rhead wrote: > > Hi Anyuan, > > I don't believe it is possible to retain the RefSeq ID in this case > when using the Table Browser. However, I think that Galaxy has > this capacity, either by doing the intersection from scratch using > their tools, or by joining your MAF with your custom track based on > the genome coordinates. > > Galaxy has screencasts: > http://galaxy.psu.edu/screencasts.html > > and a wiki: > http://g2.trac.bx.psu.edu/ > > This screencast might be particularly helpful: > http://screencast.g2.bx.psu.edu/galaxy/MAF_manipulation/ > > If you have more questions about how to accomplish your task using > Galaxy, you can contact them at galaxy-user(a)bx.psu.edu. > > Good luck with your research. > > -- > Brooke Rhead > UCSC Genome Bioinformatics Group > > > a lot of at galaxy-user(a)bx.psu.edu for help. > > On 12/10/08 15:17, Anyuan Guo wrote: >> Dear Brooke, >> Thanks very much. I learned a lot about creating custom track >> in your email. I can download a ~76Mb compressed file when I >> follow your instruction to create a custom track for upstream 1000 >> bp of RefseqGene and intersect with 17-way Cons. But I found the >> file format is not begin with Refseq ID (NM_xxxx). The following >> is the first 4 lines of the file. >> ##maf version=1 >> a score=-55252.000000 >> s hg18.chr1 14754 99 + 247249719 >> CTGTGGGTCGGAGCCGGAGCGTCAGAGC---------CACCCACGACCACCGGCACGCC---- >> CCCACCACA-GGGCAGCGTGG-TGTTGAGACAAC------A >> >> In fact, I need a file begin with Refseq ID, the downloaded >> maf file (http://hgdownload.cse.ucsc.edu/goldenPath/hg18/multiz17way/upstream1000.m... >> ) exactly match my requirement. But because some refseq sequences >> were updated, the downloaded file is out of date. >> The following is the first 4 lines of the downloaded file, >> which I need. >> ##maf version=1 scoring=zero >> a score=0.000000 >> s NM_198943 0 1000 + 1000 GCATTTTAAACCCAAGTG---- >> AAATCTCCTAGG----------CCCTTCATGCCACACTCA-----TCCATCCCTACCTAC-- >> TTGTGTTGCAACCAAGGGCCCCAC >> >> How can I get the up-to-date version of this download file? >> Thanks. >> >> Anyuan >> >> >> Brooke Rhead wrote: >>> Hello Anyuan, >>> >>> The reason that the sequence is different via the download file >>> and the Table Browser is that the sequence associated with >>> NM_014223 at RefSeq has changed since the download file was >>> made. The items in the RefSeq Genes track are updated daily; the >>> download files are generally only made once. >>> >>> You can see the revision history for any GenBank accession at NCBI: >>> http://www.ncbi.nlm.nih.gov/entrez/sutils/girevhist.cgi?val=NM_014223 >>> >>> The download file was last updated on 7-7-2007. I tried blatting >>> the NM_014223 sequence from the "Jun 3 2007 1:10 PM" update to >>> the hg18 assembly, and the sequence aligned starting at the >>> genomic coordinate chr1:40,929,952. The upstream sequence from >>> the file you downloaded corresponds to the 1,000 bases upstream >>> of that base. >>> >>> You can get an up-to-date version of the download file by >>> creating yourself with the Table Browser. First, make a custom >>> track of the upstream regions of RefSeq Genes. If you select the >>> RefSeq Genes track in the Table Browser and choose "output >>> format: custom track", you will be presented with an option to >>> create one BED record per region that is "Upstream by ___ >>> bases". Enter 1,000 or 2,000 in this box and hit "get custom >>> track in genome browser". You should see a new custom track >>> containing blocks representing regions upstream of all RefSeq >>> Genes. >>> >>> Now you can intersect your new custom track with the multiz >>> alignment in the Conservation track to get only the upstream >>> regions. To do this step, select the 17-way (or 28-way) >>> Conservation track in the Table Browser. Select the table >>> 'multiz17way' and region: genome. Hit the "intersection: create" >>> button and select your custom track. Choose the option for "Base- >>> pair-wise intersection (AND) of 17-Way Cons and upstream regions >>> from refGene" and hit submit. Back on the main Table Browser >>> page, select "output format: MAF". The size of the file you will >>> be creating is quite large (76 Mb compressed for 1,000 base >>> regions). I suggest entering a name for the file and selecting >>> the option to get a gzip compressed version of it. Hit "get >>> output". You should end up with a MAF file that contains only >>> the regions upstream of RefSeq Genes. >>> >>> You may also be interested in the tools for working with MAF >>> alignments at Galaxy: http://galaxy.psu.edu/ . Galaxy is run by >>> our collaborators at Penn State and extends the functionality of >>> the Table Browser. For instance, there is a tool to filter any >>> undesired species from a MAF file, leaving only the species of >>> interest to you. >>> >>> I hope this is helpful. If you have further questions, please >>> feel free to contact us again at genome(a)soe.ucsc.edu. If you >>> have questions specific to Galaxy, their helpdesk email address >>> is galaxy-user(a)bx.psu.edu. >>> >>> -- >>> Brooke Rhead >>> UCSC Genome Bioinformatics Group >>> >>> >>> >>> Subject: question or bug about UCSC genome browser sequence >>> From: Anyuan Guo <aguo(a)vcu.edu&gt; >>> Date: Mon, 17 Nov 2008 10:54:21 -0800 >>> To: genome(a)soe.ucsc.edu >>> >>> >>> Dear author, >>> Thanks for you providing the wonderful database and website >>> of UCSC >>> genome browser. >>> I have question about the sequence in it. >>> I downloaded the human upstream 1000bp multiz alignment >>> file from >>> ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/multiz17way/upstream1000.ma... >>> When I check my sequence id NM_014223. >>> I can find the upstream 1000 bp sequence of this refseq gene >>> in the >>> downloaded multiz alignment file. >>> I also can search this id in genome browser and get the >>> upstream >>> 1000 bp using the "DNA" or "Tables" menu at the top of genome >>> browser page. >>> But I find these two upstream 1000 bp sequence are totally >>> different. I think the one using genome browser is right. >>> But I am not just need the upstream 1000bp sequence, I need the >>> alignment with mouse sequence. >>> >>> Can I just get the sequence alignment between human and mouse >>> for >>> all the refseq gene and the upstream 1000 or 2000 of these genes? >>> Where >>> can I find it? >>> I think those ortholog gene alignment (including upstream >>> regulatory sequence alignment) between two popular genome will be >>> very >>> useful. >>> >>> thanks. >>> >>> Anyuan >>> _______________________________________________ galaxy-user mailing list galaxy-user(a)bx.psu.edu http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user