Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this?
For example,
*AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG
From this sequence, I want to remove *AATGATACGGCGACCACCG,*
*so I can get "**AACACTGCGTTTGCTGGCTTTG*ATG" only.
If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much!
Best,
*Seung Hee *
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the "Cut" tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5
Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed
Take care,
Jen Galaxy team
On 11/18/13 12:56 PM, Seung Hee Cho wrote:
Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this?
For example,
*AATGATACGGC_GACCACCG _*_AACACTGCGTTTGCTGGCTTTG_ATG From this sequence, I want to remove *AATGATACGGC_GACCACCG,_* *_so I can get _ "*_AACACTGCGTTTGCTGGCTTTG_ATG" only.
If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much!
Best, *Seung Hee *
The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
To search Galaxy mailing lists use the unified search at:
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson jen@bx.psu.edu wrote:
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the "Cut" tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5
Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed
This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets:
http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip
Regards,
Peter
You might also use ( / add to main) the CutAdapt tool, which is available in the main toolshed. It takes multiple adapters, allows 3/5/both side adapters, and is fast.
http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=User.username&...
Best,
Geert
On 11/23/2013 03:19 PM, Peter Cock wrote:
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson jen@bx.psu.edu wrote:
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the "Cut" tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5
Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed
This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets:
http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip
Regards,
Peter ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
To search Galaxy mailing lists use the unified search at:
Thanks Geert, This tool was in the back on my mind, but I couldn't find it last week for some reason!
Seung Hee - this is a very good choice, for use in a local or or cloud Galaxy. http://getgalaxy.org http://usegalaxy.org/cloud
I think I will close out the ticket below and point it to CutAdapt as a solution. A ticket to ask for this tool to be on Main is a distinct subject/issue - if someone wants to submit that request, the community can vote, team can priotitize, etc. http://wiki.galaxyproject.org/Issues
The tool Peter mentions can also be examined. One may fit your needs better than the other,
Thanks!! Jen Galaxy team
On 11/25/13 6:03 AM, Geert Vandeweyer wrote:
You might also use ( / add to main) the CutAdapt tool, which is available in the main toolshed. It takes multiple adapters, allows 3/5/both side adapters, and is fast.
http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=User.username&...
Best,
Geert
On 11/23/2013 03:19 PM, Peter Cock wrote:
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jacksonjen@bx.psu.edu wrote:
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the "Cut" tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5
Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks).http://usegalaxy.org/toolshed
This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets:
http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip
Regards,
Peter ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
To search Galaxy mailing lists use the unified search at:
--
Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail:geert.vandeweyer@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/in/geertvandeweyer
The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
To search Galaxy mailing lists use the unified search at:
Thanks Peter for another option!
Jen Galaxy team
On 11/23/13 6:19 AM, Peter Cock wrote:
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson jen@bx.psu.edu wrote:
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the "Cut" tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5
Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed
This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets:
http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip
Regards,
Peter
galaxy-user@lists.galaxyproject.org