Hello,
Is there a way to fetch the promoter regions for homologous genes from different species. E.g. say I'd like to fetch the promoter region for a drosophila gene CG13222 from drosophila as well as its CG13222 homologues in other flies from UCSC genome browser?
Thanks, Lin
Linda:
Suppose you want to fetch sequences of homologous promoters for all Drosophila genes. Here is an outline of how to do this:
1. Download coordinates of flybase genes from Drosophila melanogaster dm2 genome build (see attached images 1 and 2). 2. Use "Operate on Genomic Intervals -> Get Flanks" to convert coordinates of genes into coordinates of putative promoters by taking 500 bp upstream of each gene (see attached images 3). 3. Use "Fetch alignments -> Stitch MAF blocks" to retrieve homologous sequences for several species (see attached image 4).
You will get alignments in FASTA format corresponding to your promoters. They will look like this:
dm2.chr2L(+):825463-825963
CAAAGAGCGTCTCTCCGTCATCTCTATTCACGGCGTAGACCGTGAACCCGTAGCCGG
droYak2
CAAAAAGCGTCTCTCCGTCATCTCTTTTTACGGCGTATGCGGTGAATCCGTACCCGG
dp4
CAAAGAGCGTCTCGCCGTCGGAGCGCTGGACAGCGTAGGCGGTGAAGCCATAACCAG
Let us know you have problems.
Thanks,
anton galaxy team
On Dec 23, 2009, at 12:23 AM, Linda Barnum wrote:
Hello,
Is there a way to fetch the promoter regions for homologous genes from different species. E.g. say I'd like to fetch the promoter region for a drosophila gene CG13222 from drosophila as well as its CG13222 homologues in other flies from UCSC genome browser?
Thanks, Lin _______________________________________________ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user
Anton Nekrutenko http://nekrut.bx.psu.edu http://galaxyproject.org
Hi Linda,
Multiz 15-way alignments for dm3 are now available for use on the test instance of Galaxy located at http://test.g2.bx.psu.edu/. They'll be made available on our main server shortly.
Thanks, Guru Galaxy team.
On Dec 24, 2009, at 3:18 PM, Anton Nekrutenko wrote:
Linda:
Suppose you want to fetch sequences of homologous promoters for all Drosophila genes. Here is an outline of how to do this:
- Download coordinates of flybase genes from Drosophila melanogaster dm2 genome build (see attached images 1 and 2).
- Use "Operate on Genomic Intervals -> Get Flanks" to convert coordinates of genes into coordinates of putative promoters by taking 500 bp upstream of each gene (see attached images 3).
- Use "Fetch alignments -> Stitch MAF blocks" to retrieve homologous sequences for several species (see attached image 4).
You will get alignments in FASTA format corresponding to your promoters. They will look like this:
dm2.chr2L(+):825463-825963
CAAAGAGCGTCTCTCCGTCATCTCTATTCACGGCGTAGACCGTGAACCCGTAGCCGG
droYak2
CAAAAAGCGTCTCTCCGTCATCTCTTTTTACGGCGTATGCGGTGAATCCGTACCCGG
dp4
CAAAGAGCGTCTCGCCGTCGGAGCGCTGGACAGCGTAGGCGGTGAAGCCATAACCAG
Let us know you have problems.
Thanks,
anton galaxy team
<Picture 1.png>
<Picture 2.png> <Picture 3.png><Picture 4.png>On Dec 23, 2009, at 12:23 AM, Linda Barnum wrote:
Hello,
Is there a way to fetch the promoter regions for homologous genes from different species. E.g. say I'd like to fetch the promoter region for a drosophila gene CG13222 from drosophila as well as its CG13222 homologues in other flies from UCSC genome browser?
Thanks, Lin _______________________________________________ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user
Anton Nekrutenko http://nekrut.bx.psu.edu http://galaxyproject.org
galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user
Guruprasad Ananda Graduate Student Bioinformatics and Genomics The Pennsylvania State University
galaxy-user@lists.galaxyproject.org