On Thu, Aug 2, 2012 at 7:50 PM, D. A. Cowart dac330@psu.edu wrote:

Hello,

I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been organized and sorted by species. The format of the data is as follows:

That was probably FASTA format (but mangled in the email).

I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy?

Use the "Compute sequence length" tool to compute the read lengths, and then you should be able to compute some statistics about the lengths.

Peter

Hi,

"Summary Statistics" is ok, but before you need to use the tool 'Compute sequence length'.

Ciao, Bjoern

Am 23.05.2014 13:29, schrieb Dominique Cowart:

Hello,

I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been divided into columns:

...

HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT

I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy?

Thank you in advance,

Dominique Cowart

---

The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/

Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar.

For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists, please use the interface at:

http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

http://galaxyproject.org/search/mailinglists/

Hi Dominique, I’d use the original fasta file and input it into the 'Fasta Manipulation > Compute Sequence Length' tool Then, using the output, run the 'Statistics > Summary Statistics for any numerical column' tool on c2. That will give you all the info you’re after. Cheers, Graham

Dr. Graham Etherington Bioinformatics Support Officer, The Sainsbury Laboratory, Norwich Research Park, Norwich NR4 7UH. UK Tel: +44 (0)1603 450601 Twitter: @bioinformatiks

From: Dominique Cowart <dac330@gmail.commailto:dac330@gmail.com> Date: Friday, 23 May 2014 12:29 To: "galaxy-user@bx.psu.edumailto:galaxy-user@bx.psu.edu" <galaxy-user@bx.psu.edumailto:galaxy-user@bx.psu.edu> Subject: [galaxy-user] Summary Statistics

Hello,

I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been divided into columns:

HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT

I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy?

Thank you in advance,

Dominique Cowart