Hello! I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with SOAPdenovo.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting . for example: T02023221102101032002002030011232121133222233311200 ��> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 lishiyong
Lishiyong, You should not convert colorspace to base space prior to aligning reads. The reason for this is that if there is an error in one of the color calls, it will effect all the downstream color calls. Instead, you should use an aligner that will do the assembly in color-space instead. I know there are a few out there, but don't know them off the top of my head. Ryan On 3/27/11 11:35 PM, lishiyong wrote:
Hello!
I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting .
for example:
T02023221102101032002002030011232121133222233311200 ——> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 ------------------------------------------------------------------------ lishiyong
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- CONFIDENTIALITY NOTICE: This email communication may contain private, confidential, or legally privileged information intended for the sole use of the designated and/or duly authorized recipient(s). If you are not the intended recipient or have received this email in error, please notify the sender immediately by email and permanently delete all copies of this email including all attachments without reading them. If you are the intended recipient, secure the contents in a manner that conforms to all applicable state and/or federal requirements related to privacy and confidentiality of such information.
Hello Lishiyong, Just to confirm, the conversion was performed at Galaxy main using "NGS: QC and manipulation -> Convert SOLiD output to fastq"? With the option "double encode = yes"? If so, the output appears to be correct. quote from tool help: "Double encode? - converts color calls (0123.) to pseudo-nucleotides (ACGTN). Not necessary for bowtie. Required for BWA." Please let us know if we can help more, Best, Jen Galaxy team On 3/27/11 8:35 PM, lishiyong wrote:
Hello!
I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting .
for example:
T02023221102101032002002030011232121133222233311200 ——> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 ------------------------------------------------------------------------ lishiyong
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org
Hello collegues, I have two questions which I could not get answered. I have Illumina single end sequences files, and want to use them for ChIP-Seq analysis. My first question is: In Galaxy screencasts (ChIP-Seq analysis for TAF1-protein...) he does not tell how he has generated the txt. format of the file used for demonstration of ChIP-Seq analysis. I would like to know how I can generate that file from my Illumina sequence files to proceed with analysis. My second question is, 2) How can I convert SAM/BAM formated files (generated by Bowtei mapping tool at Galaxy) to Wiggle or Bigwig formats. I would be thankful for the answers and comments. Falak ________________________________________ From: galaxy-user-bounces@lists.bx.psu.edu [galaxy-user-bounces@lists.bx.psu.edu] On Behalf Of Jennifer Jackson [jen@bx.psu.edu] Sent: Monday, March 28, 2011 9:57 AM To: lishiyong Cc: galaxy-user Subject: Re: [galaxy-user] Convert SOLiD data Hello Lishiyong, Just to confirm, the conversion was performed at Galaxy main using "NGS: QC and manipulation -> Convert SOLiD output to fastq"? With the option "double encode = yes"? If so, the output appears to be correct. quote from tool help: "Double encode? - converts color calls (0123.) to pseudo-nucleotides (ACGTN). Not necessary for bowtie. Required for BWA." Please let us know if we can help more, Best, Jen Galaxy team On 3/27/11 8:35 PM, lishiyong wrote:
Hello!
I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting .
for example:
T02023221102101032002002030011232121133222233311200 ——> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 ------------------------------------------------------------------------ lishiyong
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
On Mon, Mar 28, 2011 at 3:11 PM, Sher, Falak wrote:
My second question is, 2) How can I convert SAM/BAM formated files (generated by Bowtie mapping tool at Galaxy) to Wiggle or Bigwig formats.
Brad Chapman has written a Galaxy tool for converting BAM to BigWig, called "Calculates coverage from a BAM alignment file". This is available from the Galaxy Tool Shed http://community.g2.bx.psu.edu/ if you have your own local install of Galaxy. It uses a Python script (which can be run easily outside Galaxy) which converts from BAM to Wiggle, and then calls the wigToBigWig tool from UCSC to convert this to a BigWig file. Peter
Hello Falak, In the screencast, the data for the TAF1- binding sites is from the ENCODE pilot project. You can find many TAF1 datasets (ChIP-chip and ChIP-seq) at the ENCODE DCC: http://genome.ucsc.edu/ENCODE Is it that you want to use your own data (after it is mapped) and compare to known genes/regions, as in the TAF1 tutorial? If so, example 3 in this tutorial can help you understand the NGS tools: http://main.g2.bx.psu.edu/u/aun1/p/ngs-analysis-service Peter's help (separate email) about the file conversion would be a good choice. (thanks again Peter!) Best, Jen Galaxy team On 3/28/11 7:11 AM, Sher, Falak wrote:
Hello collegues, I have two questions which I could not get answered. I have Illumina single end sequences files, and want to use them for ChIP-Seq analysis. My first question is: In Galaxy screencasts (ChIP-Seq analysis for TAF1-protein...) he does not tell how he has generated the txt. format of the file used for demonstration of ChIP-Seq analysis. I would like to know how I can generate that file from my Illumina sequence files to proceed with analysis. My second question is, 2) How can I convert SAM/BAM formated files (generated by Bowtei mapping tool at Galaxy) to Wiggle or Bigwig formats. I would be thankful for the answers and comments. Falak
________________________________________ From: galaxy-user-bounces@lists.bx.psu.edu [galaxy-user-bounces@lists.bx.psu.edu] On Behalf Of Jennifer Jackson [jen@bx.psu.edu] Sent: Monday, March 28, 2011 9:57 AM To: lishiyong Cc: galaxy-user Subject: Re: [galaxy-user] Convert SOLiD data
Hello Lishiyong,
Just to confirm, the conversion was performed at Galaxy main using "NGS: QC and manipulation -> Convert SOLiD output to fastq"? With the option "double encode = yes"? If so, the output appears to be correct.
quote from tool help:
"Double encode? - converts color calls (0123.) to pseudo-nucleotides (ACGTN). Not necessary for bowtie. Required for BWA."
Please let us know if we can help more,
Best,
Jen Galaxy team
On 3/27/11 8:35 PM, lishiyong wrote:
Hello!
I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting .
for example:
T02023221102101032002002030011232121133222233311200 ——> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 ------------------------------------------------------------------------ lishiyong
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org
participants (5)
-
Jennifer Jackson -
lishiyong -
Peter Cock -
Ryan Golhar -
Sher, Falak