1 new commit in galaxy-central:
https://bitbucket.org/galaxy/galaxy-central/changeset/9a568ceeb9f5/ changeset: 9a568ceeb9f5 user: fubar date: 2012-02-10 00:40:00 summary: Updates to FastQC wrapper 1) improvement suggested by bwlang to pass the history file name in as the file name to fastqc so it appears in the outputs instead of the previously unhelpful internal galaxy filename 2) lack of html output from fastqc or return of non-zero error code now triggers job failure - outputs may still be there but at least it goes red. affected #: 2 files
diff -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 -r 9a568ceeb9f5e281e7ae3c09d6049ac7d16183d4 tools/rgenetics/rgFastQC.py --- a/tools/rgenetics/rgFastQC.py +++ b/tools/rgenetics/rgFastQC.py @@ -37,6 +37,7 @@ fastqc_data.txt per_base_gc_content.png per_base_sequence_content.png sequence_length_distribution.png warning.png
""" + serr = '' dummy,tlog = tempfile.mkstemp(prefix='rgFastQClog') sout = open(tlog, 'w') fastq = os.path.basename(self.opts.input) @@ -45,12 +46,18 @@ cl.append('-f %s' % self.opts.informat) if self.opts.contaminants <> None : cl.append('-c %s' % self.opts.contaminants) - cl.append(self.opts.input) + # patch suggested by bwlang https://bitbucket.org/galaxy/galaxy-central/pull-request/30 + # use a symlink in a temporary directory so that the FastQC report reflects the history input file name + fastqinfilename = os.path.basename(self.opts.inputfilename).replace(' ','_') + link_name = os.path.join(self.opts.outputdir, fastqinfilename) + os.symlink(self.opts.input, link_name) + cl.append(link_name) p = subprocess.Popen(' '.join(cl), shell=True, stderr=sout, stdout=sout, cwd=self.opts.outputdir) - return_value = p.wait() + retval = p.wait() sout.close() runlog = open(tlog,'r').readlines() os.unlink(tlog) + os.unlink(link_name) flist = os.listdir(self.opts.outputdir) # fastqc plays games with its output directory name. eesh odpath = None for f in flist: @@ -65,7 +72,8 @@ rep = open(hpath,'r').readlines() # for our new html file but we need to insert our stuff after the <body> tag except: pass - if hpath == None: + if hpath == None: + serr = '\n'.join(runlog) res = ['## odpath=%s: No output found in %s. Output for the run was:<pre>\n' % (odpath,hpath),] res += runlog res += ['</pre>\n', @@ -74,7 +82,7 @@ 'It is also possible that the log shows that fastqc is not installed?<br/>\n', 'If that is the case, please tell the relevant Galaxy administrator that it can be snarfed from<br/>\n', 'http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/<br/>\n',] - return res + return res,1,serr self.fix_fastqcimages(odpath) flist = os.listdir(self.opts.outputdir) # these have now been fixed excludefiles = ['tick.png','warning.png','fastqc_icon.png','error.png'] @@ -84,7 +92,7 @@ rep[i] = rep[i].replace('Images/','')
html = self.fix_fastqc(rep,flist,runlog) - return html + return html,retval,serr
@@ -129,6 +137,7 @@ if __name__ == '__main__': op = optparse.OptionParser() op.add_option('-i', '--input', default=None) + op.add_option('-j', '--inputfilename', default=None) op.add_option('-o', '--htmloutput', default=None) op.add_option('-d', '--outputdir', default="/tmp/shortread") op.add_option('-f', '--informat', default='fastq') @@ -141,9 +150,12 @@ if not os.path.exists(opts.outputdir): os.makedirs(opts.outputdir) f = FastQC(opts) - html = f.run_fastqc() + html,retval,serr = f.run_fastqc() f = open(opts.htmloutput, 'w') f.write(''.join(html)) f.close() + if retval <> 0: + print >> sys.stderr, serr # indicate failure +
diff -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 -r 9a568ceeb9f5e281e7ae3c09d6049ac7d16183d4 tools/rgenetics/rgFastQC.xml --- a/tools/rgenetics/rgFastQC.xml +++ b/tools/rgenetics/rgFastQC.xml @@ -1,7 +1,7 @@ -<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.3"> +<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.4"><description>using FastQC from Babraham</description><command interpreter="python"> - rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc + rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -j $input_file.name -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc #if $contaminants.dataset and str($contaminants) > '' -c "$contaminants" #end if @@ -16,7 +16,7 @@ help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/></inputs><outputs> - <data format="html" name="html_file" label="${out_prefix}.html" /> + <data format="html" name="html_file" label="${out_prefix}_${on_string}.html" /></outputs><tests><test>
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.