Hi Roberto, I'm happy you solved your issue, thanks for sharing the solution! I'd suggest you open a pull request with the fixes at https://github.com/galaxyproject/galaxy . Cheers, Nicola Il 25.02.2015 15:07 Roberto Alonso CIPF ha scritto:
Hello again :), I have found the problem, the code that merge the files is this:
This concatenates the file name into the sam file. Just adding "h" it is enough, so it will be like
galaxy/datatypes/tabular.py:484: cmd = 'egrep -v "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file ) this:
galaxy/datatypes/tabular.py:484: cmd = 'egrep -Hv "^@" %s >>
%s' % ( ' '.join(split_files[1:]), output_file )
Thanks all for your help, best regards
On 25 February 2015 at 12:31, Roberto Alonso CIPF wrote:
Ok, I think I understand the line: beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
it refers to the original command, so everything is fine with this line. The other problem still remains Regards, sorry for the confusion
On 25 February 2015 at 11:40, Roberto Alonso CIPF wrote:
Hello again, this is something that I consider important, when I see the log I see this output:
galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - BEGINNING MERGE: BWA MEM /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this? Thanks a lot,
Regards
On 25 February 2015 at 11:13, Roberto Alonso CIPF wrote:
Hello, I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:
https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam [3]
Best regards
On 24 February 2015 at 17:49, Peter Cock
wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF
wrote:
Hello again,
first of all thanks for your help, it is being very useful.
What I have done up to now is to copy this method to the class Sequence
def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ...
return [cmd]
get_split_commands_sequential =
staticmethod(get_split_commands_sequential)
This is
something that you suggested.
Good.
When I run the tool with this configuration:
map with bwa > split_mode="number_of_parts">
bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
$input > $output 2>/dev/null
bwa
One minor improvement would be to escape the ">" as ">" in
your XML, or use the CDATA approach documented here:
https://wiki.galaxyproject.org/Tools/BestPractices [2]
Everything ends ok, but when I go to check how is the sam, I see that in the
alingments it is the path of the file, i.e
example_split.sam:
/home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
4 * 0 0 * * 0 0
TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
############################################################################
AS:i:0 XS:i:0
you know what may be going on?
If i don't split the file, everything goes correctly.
This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)?
Peter
--
Roberto Alonso
Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralonso@cipf.es [5]
--
Roberto Alonso Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralonso@cipf.es [7]
--
Roberto Alonso Functional Genomics Unit Bioinformatics
and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralonso@cipf.es [9]
--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralonso@cipf.es [11]
Connetti gratis il mondo con la nuova indoona: hai la chat, le chiamate, le video chiamate e persino le chiamate di gruppo. E chiami gratis anche i numeri fissi e mobili nel mondo! Scarica subito l’app Vai su https://www.indoona.com/