Hello,
I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file: https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam
Best regards
On 24 February 2015 at 17:49, Peter Cock p.j.a.cock@googlemail.com wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF ralonso@cipf.es wrote:
Hello again,
first of all thanks for your help, it is being very useful.
What I have done up to now is to copy this method to the class Sequence
def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ... return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential)
This is something that you suggested.
Good.
When I run the tool with this configuration:
<tool id="bwa_mio" name="map with bwa"> <description>map with bwa</description> <parallelism method="basic" split_size="3" split_mode="number_of_parts"></parallelism>
<command> bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input > $output 2>/dev/null</command> <inputs> <param format="fastqsanger" name="input" type="data" label="fastq"/> </inputs> <outputs> <data format="sam" name="output" /> </outputs>
<help> bwa </help>
</tool>
One minor improvement would be to escape the ">" as ">" in your XML, or use the CDATA approach documented here:
https://wiki.galaxyproject.org/Tools/BestPractices
Everything ends ok, but when I go to check how is the sam, I see that in
the
alingments it is the path of the file, i.e example_split.sam:
/home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
4 * 0 0 * * 0 0
TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
############################################################################
AS:i:0 XS:i:0
you know what may be going on? If i don't split the file, everything goes correctly.
This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)?
Peter