details: http://www.bx.psu.edu/hg/galaxy/rev/5fa69a40e080 changeset: 3433:5fa69a40e080 user: Kelly Vincent kpvincent@bx.psu.edu date: Wed Feb 24 07:11:43 2010 -0500 description: Updated Bowtie test files to handle new version (0.12.3) of Bowtie (bowtie_color_wrapper will fail until new version installed). Updated samtools tools test files. Removed version references from Bowtie and BWA tools.
diffstat:
test-data/bowtie_in1.fastqsanger | 4 ++-- test-data/bowtie_out1.sam | 2 +- test-data/bowtie_out3.sam | 4 ++-- test-data/bowtie_out5.sam | 2 +- test-data/bowtie_out7.sam | 4 ++-- test-data/sam_to_bam_out1.bam | 0 tools/samtools/sam_merge.xml | 2 +- tools/samtools/sam_pileup.xml | 2 +- tools/samtools/sam_to_bam.xml | 2 +- tools/sr_mapping/bowtie_color_wrapper.xml | 30 ++++++++++++++---------------- tools/sr_mapping/bowtie_wrapper.xml | 30 ++++++++++++++---------------- tools/sr_mapping/bwa_wrapper.xml | 2 -- 12 files changed, 39 insertions(+), 45 deletions(-)
diffs (223 lines):
diff -r b4dd38c06398 -r 5fa69a40e080 test-data/bowtie_in1.fastqsanger --- a/test-data/bowtie_in1.fastqsanger Tue Feb 23 23:17:09 2010 -0500 +++ b/test-data/bowtie_in1.fastqsanger Wed Feb 24 07:11:43 2010 -0500 @@ -1,4 +1,4 @@ @869_1532_1255/1 -G21022233110003122233210021301222000112122113330022 +G2102223311000312223321002 + -=;8:?@=?;;9:8;=>;5A?;<8><<=:9><;9<=8;96>8<5==:<98; \ No newline at end of file +=;8:?@=?;;9:8;=>;5A?;<8>< diff -r b4dd38c06398 -r 5fa69a40e080 test-data/bowtie_out1.sam --- a/test-data/bowtie_out1.sam Tue Feb 23 23:17:09 2010 -0500 +++ b/test-data/bowtie_out1.sam Wed Feb 24 07:11:43 2010 -0500 @@ -1,1 +1,1 @@ -869_1532_1255/1 16 chrM 3728 255 48M * 0 0 GAAATATGTCTGACAAAAGAGTTACTTTGATAGAGTAAAACATAGAGG "TUVYQPSUSNSRTXTSVYVRVXWYUSVY_UOXZWRQRSUY[^XQR! XA:i:1 MD:Z:48 NM:i:0 CM:i:2 +869_1532_1255/1 16 chrM 3753 255 23M * 0 0 TTTGATAGAGTAAAACATAGAGG YUSVY_UOXZWRQRSUY[^XQ! XA:i:1 MD:Z:23 NM:i:0 CM:i:1 diff -r b4dd38c06398 -r 5fa69a40e080 test-data/bowtie_out3.sam --- a/test-data/bowtie_out3.sam Tue Feb 23 23:17:09 2010 -0500 +++ b/test-data/bowtie_out3.sam Wed Feb 24 07:11:43 2010 -0500 @@ -1,2 +1,2 @@ -869_1532_1255 179 chrM 3727 255 25M = 3752 50 GGAAATATGTCTGACAAAAGAGTTA !!RVYVSTXTRSNSUSPQYVUTPR; XA:i:1 MD:Z:25 NM:i:0 CM:i:1 -869_1532_1255 115 chrM 3752 255 25M = 3727 -50 CTTTGATAGAGTAAAACATAGAGGC >USVY_UOXZWRQRSUY[^XQR!! XA:i:1 MD:Z:25 NM:i:0 CM:i:1 +869_1532_1255 179 chrM 3727 255 25M = 3752 50 GGAAATATGTCTGACAAAAGAGTTA !"VRVYVSTXTRSNSUSPQYVUTP8 XA:i:1 MD:Z:25 NM:i:0 CM:i:1 +869_1532_1255 115 chrM 3752 255 25M = 3727 -50 CTTTGATAGAGTAAAACATAGAGGC <YUSVY_UOXZWRQRSUY[^XQ!! XA:i:1 MD:Z:25 NM:i:0 CM:i:1 diff -r b4dd38c06398 -r 5fa69a40e080 test-data/bowtie_out5.sam --- a/test-data/bowtie_out5.sam Tue Feb 23 23:17:09 2010 -0500 +++ b/test-data/bowtie_out5.sam Wed Feb 24 07:11:43 2010 -0500 @@ -1,1 +1,1 @@ -869_1532_1255/1 16 chrM 3727 255 50M * 0 0 GGAAATATGTCTGACAAAAGAGTTACTTTGATAGAGTAAAACATAGAGGC !"TUVYQPSUSNSRTXTSVYVRVXWYUSVY_UOXZWRQRSUY[^XQR!! XA:i:1 MD:Z:50 NM:i:0 CM:i:2 +869_1532_1255/1 16 chrM 3752 255 25M * 0 0 CTTTGATAGAGTAAAACATAGAGGC <YUSVY_UOXZWRQRSUY[^XQ!! XA:i:1 MD:Z:25 NM:i:0 CM:i:1 diff -r b4dd38c06398 -r 5fa69a40e080 test-data/bowtie_out7.sam --- a/test-data/bowtie_out7.sam Tue Feb 23 23:17:09 2010 -0500 +++ b/test-data/bowtie_out7.sam Wed Feb 24 07:11:43 2010 -0500 @@ -1,2 +1,2 @@ -869_1532_1255 179 chrM 3728 255 23M = 3752 47 GAAATATGTCTGACAAAAGAGTT !RVYVSTXTRSNSUSPQYVUTPR XA:i:1 MD:Z:23 NM:i:0 CM:i:1 -869_1532_1255 115 chrM 3753 255 23M = 3727 -49 TTTGATAGAGTAAAACATAGAGG USVY_UOXZWRQRSUY[^XQR! XA:i:1 MD:Z:23 NM:i:0 CM:i:1 +869_1532_1255 179 chrM 3728 255 23M = 3752 47 GAAATATGTCTGACAAAAGAGTT "VRVYVSTXTRSNSUSPQYVUTP XA:i:1 MD:Z:23 NM:i:0 CM:i:1 +869_1532_1255 115 chrM 3753 255 23M = 3727 -49 TTTGATAGAGTAAAACATAGAGG YUSVY_UOXZWRQRSUY[^XQ! XA:i:1 MD:Z:23 NM:i:0 CM:i:1 diff -r b4dd38c06398 -r 5fa69a40e080 test-data/sam_to_bam_out1.bam Binary file test-data/sam_to_bam_out1.bam has changed diff -r b4dd38c06398 -r 5fa69a40e080 tools/samtools/sam_merge.xml --- a/tools/samtools/sam_merge.xml Tue Feb 23 23:17:09 2010 -0500 +++ b/tools/samtools/sam_merge.xml Wed Feb 24 07:11:43 2010 -0500 @@ -1,4 +1,4 @@ -<tool id="sam_merge" name="Merge BAM Files" version="1.0.0"> +<tool id="sam_merge" name="Merge BAM Files" version="1.1.0"> <description>merges BAM files together</description> <command interpreter="python"> sam_merge.py diff -r b4dd38c06398 -r 5fa69a40e080 tools/samtools/sam_pileup.xml --- a/tools/samtools/sam_pileup.xml Tue Feb 23 23:17:09 2010 -0500 +++ b/tools/samtools/sam_pileup.xml Wed Feb 24 07:11:43 2010 -0500 @@ -1,4 +1,4 @@ -<tool id="sam_pileup" name="Generate pileup" version="1.0.0"> +<tool id="sam_pileup" name="Generate pileup" version="1.1.0"> <description>from BAM dataset</description> <command interpreter="python"> sam_pileup.py diff -r b4dd38c06398 -r 5fa69a40e080 tools/samtools/sam_to_bam.xml --- a/tools/samtools/sam_to_bam.xml Tue Feb 23 23:17:09 2010 -0500 +++ b/tools/samtools/sam_to_bam.xml Wed Feb 24 07:11:43 2010 -0500 @@ -1,4 +1,4 @@ -<tool id="sam_to_bam" name="SAM-to-BAM" version="1.0.0"> +<tool id="sam_to_bam" name="SAM-to-BAM" version="1.1.0"> <description>converts SAM format to BAM format</description> <command interpreter="python"> sam_to_bam.py --input1=$source.input1 --dbkey=${input1.metadata.dbkey} diff -r b4dd38c06398 -r 5fa69a40e080 tools/sr_mapping/bowtie_color_wrapper.xml --- a/tools/sr_mapping/bowtie_color_wrapper.xml Tue Feb 23 23:17:09 2010 -0500 +++ b/tools/sr_mapping/bowtie_color_wrapper.xml Wed Feb 24 07:11:43 2010 -0500 @@ -197,12 +197,12 @@ <option value="history">Use one from the history</option> </param> <when value="indexed"> - <param name="index" type="select" label="Select the reference genome" help="if your genome of interest is not listed - contact Galaxy team"> - <options from_file="bowtie_indices_color.loc"> - <column name="value" index="1" /> - <column name="name" index="0" /> - </options> - </param> + <param name="index" type="select" label="Select the reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="bowtie_indices_color.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + </options> + </param> </when> <when value="history"> <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> @@ -252,7 +252,7 @@ </when> <!-- cIndexFull --> </conditional> <!-- cIndexParams --> </when> <!-- cHistory --> - </conditional> <!-- cRefGenomeSource --> + </conditional> <!-- cRefGenomeSource --> <conditional name="singlePaired"> <param name="sPaired" type="select" label="Is this library mate-paired?"> <option value="single">Single-end</option> @@ -262,9 +262,9 @@ <param name="sInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> <conditional name="sParams"> <param name="sSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="preSet">Commonly used</option> - <option value="full">Full parameter list</option> - </param> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> <when value="preSet" /> <when value="full"> <param name="sSkip" type="integer" value="0" label="Skip the first n reads (-s)" /> @@ -327,9 +327,9 @@ </param> <conditional name="pParams"> <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="preSet">Commonly used</option> - <option value="full">Full parameter list</option> - </param> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> <when value="preSet" /> <when value="full"> <param name="pSkip" type="integer" value="0" label="Skip the first n pairs (-s)" /> @@ -417,7 +417,7 @@ <!-- Bowtie command: bowtie-build -f -C test-data/chr_m.fasta chrM_color - bowtie -X 1000 +ff -n 2 -e 70 -l 28 -X 250 +ff +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam + bowtie -X 1000 +ff -n 2 -e 70 -l 28 -X 250 +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> @@ -533,8 +533,6 @@
Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. Please cite: Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25.
-This tool uses Bowtie version 0.12.1. - .. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml
------ diff -r b4dd38c06398 -r 5fa69a40e080 tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Tue Feb 23 23:17:09 2010 -0500 +++ b/tools/sr_mapping/bowtie_wrapper.xml Wed Feb 24 07:11:43 2010 -0500 @@ -191,13 +191,13 @@ <option value="history">Use one from the history</option> </param> <when value="indexed"> - <param name="index" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> - <options from_file="bowtie_indices.loc"> - <column name="value" index="1" /> - <column name="name" index="0" /> - </options> - </param> - </when> + <param name="index" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="bowtie_indices.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + </options> + </param> + </when> <when value="history"> <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> <conditional name="indexParams"> @@ -246,7 +246,7 @@ </when> <!-- indexFull --> </conditional> <!-- indexParams --> </when> <!-- history --> - </conditional> <!-- refGenomeSource --> + </conditional> <!-- refGenomeSource --> <conditional name="singlePaired"> <param name="sPaired" type="select" label="Is this library mate-paired?"> <option value="single">Single-end</option> @@ -256,9 +256,9 @@ <param name="sInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> <conditional name="sParams"> <param name="sSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="preSet">Commonly used</option> - <option value="full">Full parameter list</option> - </param> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> <when value="preSet" /> <when value="full"> <param name="sSkip" type="integer" value="0" label="Skip the first n reads (-s)" /> @@ -315,9 +315,9 @@ </param> <conditional name="pParams"> <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="preSet">Commonly used</option> - <option value="full">Full parameter list</option> - </param> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> <when value="preSet" /> <when value="full"> <param name="pSkip" type="integer" value="0" label="Skip the first n pairs (-s)" /> @@ -506,8 +506,6 @@
Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. Please cite: Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25.
-This tool uses Bowtie version 0.12.1. - .. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml
------ diff -r b4dd38c06398 -r 5fa69a40e080 tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Tue Feb 23 23:17:09 2010 -0500 +++ b/tools/sr_mapping/bwa_wrapper.xml Wed Feb 24 07:11:43 2010 -0500 @@ -181,8 +181,6 @@
BWA is a fast light-weighted tool that aligns relatively short sequences (queries) to a sequence database (large), such as the human reference genome. It is developed by Heng Li at the Sanger Insitute. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25, 1754-60.
-This tool uses BWA version 0.5.5. - ------
**Know what you are doing**