details: http://www.bx.psu.edu/hg/galaxy/rev/ec12f3ad520a changeset: 3233:ec12f3ad520a user: Kelly Vincent kpvincent@bx.psu.edu date: Wed Jan 13 14:38:40 2010 -0500 description: Tweaked the interfaces for Bowtie wrappers for paired-end data
diffstat:
test-data/bowtie_out7.sam | 4 +- tools/sr_mapping/bowtie_color_wrapper.xml | 32 ++++++++++++++---------------- tools/sr_mapping/bowtie_wrapper.py | 21 +++++++++---------- tools/sr_mapping/bowtie_wrapper.xml | 31 +++++++++++++---------------- 4 files changed, 41 insertions(+), 47 deletions(-)
diffs (308 lines):
diff -r 4b7a92551151 -r ec12f3ad520a test-data/bowtie_out7.sam --- a/test-data/bowtie_out7.sam Wed Jan 13 13:19:25 2010 -0500 +++ b/test-data/bowtie_out7.sam Wed Jan 13 14:38:40 2010 -0500 @@ -1,2 +1,2 @@ -869_1532_1255 77 * 0 0 * * 0 0 CAGGGTTCCAAATCGGGTTGCAAG =;8:?@=?;;9:8;=>;5A?;<8> XM:i:0 -869_1532_1255 141 * 0 0 * * 0 0 TACGGGAAACCGCGGCCTTTAAGG ;89<:==5<8>69;8=<9;<>9:= XM:i:0 +869_1532_1255 179 chrM 3728 255 23M = 3752 47 GAAATATGTCTGACAAAAGAGTT !RVYVSTXTRSNSUSPQYVUTPR XA:i:1 MD:Z:23 NM:i:0 CM:i:1 +869_1532_1255 115 chrM 3753 255 23M = 3727 -49 TTTGATAGAGTAAAACATAGAGG USVY_UOXZWRQRSUY[^XQR! XA:i:1 MD:Z:23 NM:i:0 CM:i:1 diff -r 4b7a92551151 -r ec12f3ad520a tools/sr_mapping/bowtie_color_wrapper.xml --- a/tools/sr_mapping/bowtie_color_wrapper.xml Wed Jan 13 13:19:25 2010 -0500 +++ b/tools/sr_mapping/bowtie_color_wrapper.xml Wed Jan 13 14:38:40 2010 -0500 @@ -9,7 +9,6 @@ --genomeSource=$refGenomeSource.genomeSource #if $refGenomeSource.genomeSource == "history": --ref=$refGenomeSource.ownFile - --dbkey=$dbkey --indexSettings=$refGenomeSource.indexParams.indexSettings #if $refGenomeSource.indexParams.indexSettings == "indexFull": --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB @@ -49,7 +48,6 @@ #end if #else: --ref=$refGenomeSource.index.value - --dbkey="None" --indexSettings="None" --iautoB="None" --ipacked="None" @@ -129,6 +127,8 @@ #else: --input1=$singlePaired.pInput1 --input2=$singlePaired.pInput2 + --maxInsert=$singlePaired.pMaxInsert + --mateOrient=$singlePaired.pMateOrient --params=$singlePaired.pParams.pSettingsType #if $singlePaired.pParams.pSettingsType == "full": --skip=$singlePaired.pParams.pSkip @@ -141,8 +141,6 @@ --rounding=$singlePaired.pParams.pRounding --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign --minInsert=$singlePaired.pParams.pMinInsert - --maxInsert=$singlePaired.pParams.pMaxInsert - --mateOrient=$singlePaired.pParams.pMateOrient --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt --forwardAlign=$singlePaired.pParams.pForwardAlign --reverseAlign=$singlePaired.pParams.pReverseAlign @@ -174,8 +172,6 @@ --rounding="None" --maqSoapAlign="None" --minInsert="None" - --maxInsert="None" - --mateOrient="None" --maxAlignAttempt="None" --forwardAlign="None" --reverseAlign="None" @@ -323,6 +319,12 @@ <when value="paired"> <param name="pInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> <param name="pInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="pMaxInsert" type="integer" value="1000" label="Maximum insert size for valid paired-end alignments (-X)" /> + <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> + <option value="ff">FF (for SOLiD)</option> + <option value="fr">FR (for Illumina)</option> + <option value="rf">RF</option> + </param> <conditional name="pParams"> <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> <option value="preSet">Commonly used</option> @@ -343,12 +345,6 @@ </param> <param name="pMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> <param name="pMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> - <param name="pMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> - <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> - <option value="ff">FF (for SOLiD)</option> - <option value="fr">FR (for Illumina)</option> - <option value="rf">RF</option> - </param> <param name="pMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> <param name="pForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> <option value="forward">Align against the forward reference strand</option> @@ -421,7 +417,7 @@ <!-- Bowtie command: bowtie-build -f -C test-data/chr_m.fasta chrM_color - bowtie -n 2 -e 70 -l 28 -X 250 +ff +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam + bowtie -X 1000 +ff -n 2 -e 70 -l 28 -X 250 +ff +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> @@ -431,6 +427,8 @@ <param name="sPaired" value="paired" /> <param name="pInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" /> <param name="pInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" /> + <param name="pMaxInsert" value="1000" /> + <param name="pMateOrient" value="ff" /> <param name="pSettingsType" value="full" /> <param name="pSkip" value="0" /> <param name="pAlignLimit" value="-1" /> @@ -442,8 +440,6 @@ <param name="pRounding" value="round" /> <param name="pMaqSoapAlign" value="-1" /> <param name="pMinInsert" value="0" /> - <param name="pMaxInsert" value="250" /> - <param name="pMateOrient" value="ff" /> <param name="pMaxAlignAttempt" value="100" /> <param name="pForwardAlign" value="forward" /> <param name="pReverseAlign" value="reverse" /> @@ -500,11 +496,11 @@ <!-- Bowtie command: bowtie-build +noauto +bmaxdivn 4 +dcv 1024 +offrate 5 +ftabchars 10 +little -C -f test-data/chr_m.fasta chrM_color - bowtie -p 4 -S +sam-nohead -q -C chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out7.sam + bowtie -X 1000 +ff -p 4 -S +sam-nohead -q -C chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out7.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> - <param name="genomeSource" value="cHistory" /> + <param name="genomeSource" value="history" /> <param name="ownFile" value="chr_m.fasta" /> <param name="indexSettings" value="indexFull" /> <param name="autoB" value="set" /> @@ -523,6 +519,8 @@ <param name="sPaired" value="paired" /> <param name="pInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" /> <param name="pInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" /> + <param name="pMaxInsert" value="1000" /> + <param name="pMateOrient" value="ff" /> <param name="pSettingsType" value="preSet" /> <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out7.sam" /> diff -r 4b7a92551151 -r ec12f3ad520a tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Wed Jan 13 13:19:25 2010 -0500 +++ b/tools/sr_mapping/bowtie_wrapper.py Wed Jan 13 14:38:40 2010 -0500 @@ -40,7 +40,6 @@ -6, --snpfrac=6: Fraction of sites expected to be SNP sites -7, --keepends=7: Keep extreme-end nucleotides and qualities -S, --seed=S: Seed for pseudo-random number generator - -d, --dbkey=d: Dbkey of reference genome -C, --params=C: Whether to use default or specified parameters -u, --iautoB=u: Automatic or specified behavior -K, --ipacked=K: Whether or not to use a packed representation for DNA strings @@ -103,7 +102,6 @@ parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' ) parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' ) parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' ) - parser.add_option( '-d', '--dbkey', dest='dbkey', help='Dbkey of reference genome' ) parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' ) parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' ) parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' ) @@ -206,8 +204,17 @@ suppressHeader = '--sam-nohead' else: suppressHeader = '' + if options.maxInsert != 'None' and int( options.maxInsert ) > 0: + maxInsert = '-X %s' % options.maxInsert + else: + maxInsert = '' + if options.mateOrient != 'None': + mateOrient = '--%s' % options.mateOrient + else: + mateOrient = '' if options.params == 'preSet': - aligning_cmds = '-p %s -S %s -q %s ' % ( options.threads, suppressHeader, colorspace ) + aligning_cmds = '%s %s -p %s -S %s -q %s ' % \ + ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace ) else: try: if options.skip != 'None' and int( options.skip ) > 0: @@ -251,14 +258,6 @@ minInsert = '-I %s' % options.minInsert else: minInsert = '' - if options.maxInsert != 'None' and int( options.maxInsert ) > 0: - maxInsert = '-X %s' % options.maxInsert - else: - maxInsert = '' - if options.mateOrient != 'None': - mateOrient = '--%s' % options.mateOrient - else: - mateOrient = '' if options.maxAlignAttempt != 'None' and int( options.maxAlignAttempt ) >= 0: maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt else: diff -r 4b7a92551151 -r ec12f3ad520a tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Wed Jan 13 13:19:25 2010 -0500 +++ b/tools/sr_mapping/bowtie_wrapper.xml Wed Jan 13 14:38:40 2010 -0500 @@ -12,7 +12,6 @@ --keepends="None" #if $refGenomeSource.genomeSource == "history": --ref=$refGenomeSource.ownFile - --dbkey=$dbkey --indexSettings=$refGenomeSource.indexParams.indexSettings #if $refGenomeSource.indexParams.indexSettings == "indexFull": --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB @@ -52,7 +51,6 @@ #end if #else: --ref=$refGenomeSource.index.value - --dbkey="None" --indexSettings="None" --iautoB="None" --ipacked="None" @@ -129,6 +127,8 @@ #else: --input1=$singlePaired.pInput1 --input2=$singlePaired.pInput2 + --maxInsert=$singlePaired.pMaxInsert + --mateOrient=$singlePaired.pMateOrient --params=$singlePaired.pParams.pSettingsType #if $singlePaired.pParams.pSettingsType == "full": --skip=$singlePaired.pParams.pSkip @@ -141,8 +141,6 @@ --rounding=$singlePaired.pParams.pRounding --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign --minInsert=$singlePaired.pParams.pMinInsert - --maxInsert=$singlePaired.pParams.pMaxInsert - --mateOrient=$singlePaired.pParams.pMateOrient --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt --forwardAlign=$singlePaired.pParams.pForwardAlign --reverseAlign=$singlePaired.pParams.pReverseAlign @@ -180,8 +178,6 @@ --offrate="None" --seed="None" --minInsert="None" - --maxInsert="None" - --mateOrient="None" --maxAlignAttempt="None" --forwardAlign="None" --reverseAlign="None" @@ -311,6 +307,12 @@ <when value="paired"> <param name="pInput1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> <param name="pInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="pMaxInsert" type="integer" value="1000" label="Maximum insert size for valid paired-end alignments (-X)" /> + <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> + <option value="fr">FR (for Illumina)</option> + <option value="rf">RF</option> + <option value="ff">FF (for SOLiD)</option> + </param> <conditional name="pParams"> <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> <option value="preSet">Commonly used</option> @@ -331,12 +333,6 @@ </param> <param name="pMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> <param name="pMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> - <param name="pMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> - <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> - <option value="fr">FR (for Illumina)</option> - <option value="rf">RF</option> - <option value="ff">FF (for SOLiD)</option> - </param> <param name="pMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> <param name="pForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> <option value="forward">Align against the forward reference strand</option> @@ -403,7 +399,7 @@ <!-- Bowtie command: bowtie-build -f test-data/chr_m.fasta chrM_base - bowtie -n 2 -e 70 -l 28 -X 250 +fr +pairtries 100 +maxbts 800 -k 1 +best -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out4.sam + bowtie -X 1000 +fr -n 2 -e 70 -l 28 +pairtries 100 +maxbts 800 -k 1 +best -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out4.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> @@ -413,6 +409,8 @@ <param name="sPaired" value="paired" /> <param name="pInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" /> <param name="pInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" /> + <param name="pMaxInsert" value="1000" /> + <param name="pMateOrient" value="fr" /> <param name="pSettingsType" value="full" /> <param name="pSkip" value="0" /> <param name="pAlignLimit" value="-1" /> @@ -424,8 +422,6 @@ <param name="pRounding" value="round" /> <param name="pMaqSoapAlign" value="-1" /> <param name="pMinInsert" value="0" /> - <param name="pMaxInsert" value="250" /> - <param name="pMateOrient" value="fr" /> <param name="pMaxAlignAttempt" value="100" /> <param name="pForwardAlign" value="forward" /> <param name="pReverseAlign" value="reverse" /> @@ -441,7 +437,6 @@ <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out4.sam" /> </test> -<!-- Comment out test 3 because they are failing for an unknown reason --> <test> <!-- Bowtie command: @@ -478,7 +473,7 @@ <!-- Bowtie command: bowtie-build +offrate 5 +ftabchars 10 +little -f test-data/chr_m.fasta chrM_base - bowtie -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out8.sam + bowtie -X 1000 +fr -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out8.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> @@ -497,6 +492,8 @@ <param name="sPaired" value="paired" /> <param name="pInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" /> <param name="pInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" /> + <param name="pMaxInsert" value="1000" /> + <param name="pMateOrient" value="fr" /> <param name="pSettingsType" value="preSet" /> <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out8.sam" />