details: http://www.bx.psu.edu/hg/galaxy/rev/35d2a31cfbaf changeset: 3230:35d2a31cfbaf user: Kelly Vincent kpvincent@bx.psu.edu date: Tue Jan 12 16:49:02 2010 -0500 description: Changed the bowtie wrapper tool into two different tools: one for illumina data and one for solid
diffstat:
test-data/bowtie_in1.fastq | 5 - test-data/bowtie_in2.fastq | 4 - test-data/bowtie_in3.fastq | 4 - test-data/bowtie_in4.fastqsanger | 2 +- test-data/bowtie_out3.sam | 4 +- test-data/bowtie_out7.sam | 4 +- tool_conf.xml.sample | 1 + tools/sr_mapping/bowtie_color_wrapper.xml | 659 +++++++++++++ tools/sr_mapping/bowtie_wrapper.py | 51 +- tools/sr_mapping/bowtie_wrapper.xml | 1423 +++++++++------------------- tools/sr_mapping/bowtie_wrapper_code.py | 13 +- 11 files changed, 1141 insertions(+), 1029 deletions(-)
diffs (2385 lines):
diff -r b78de785df21 -r 35d2a31cfbaf test-data/bowtie_in1.fastq --- a/test-data/bowtie_in1.fastq Tue Jan 12 15:48:21 2010 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -@HWI-EAS91_1_30788AAXX:1:1:1513:715/1 -GTTTTTTNNGCATAGATGTTTAGTTGTGGTAGTCAG -+/1 -IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I - diff -r b78de785df21 -r 35d2a31cfbaf test-data/bowtie_in2.fastq --- a/test-data/bowtie_in2.fastq Tue Jan 12 15:48:21 2010 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -@HWI-EAS91_1_30788AAXX:1:2:618:346/1 -TAGACTACGAAAGTGACTTTAATACCTCTGACTACA -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 diff -r b78de785df21 -r 35d2a31cfbaf test-data/bowtie_in3.fastq --- a/test-data/bowtie_in3.fastq Tue Jan 12 15:48:21 2010 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -@HWI-EAS91_1_30788AAXX:1:2:618:346/2 -ATAGGCTGAATTAGCAATGGATGGTGGGGTTTATCG -+ -IIIIIIIIIIIIIII9I.II5II6DFIIIIII*I2) diff -r b78de785df21 -r 35d2a31cfbaf test-data/bowtie_in4.fastqsanger --- a/test-data/bowtie_in4.fastqsanger Tue Jan 12 15:48:21 2010 -0500 +++ b/test-data/bowtie_in4.fastqsanger Tue Jan 12 16:49:02 2010 -0500 @@ -1,4 +1,4 @@ @869_1532_1255/2 -2200333112212110002221031T +T1301222000112122113330022 + ;89<:==5<8>69;8=<9;<>9:=< diff -r b78de785df21 -r 35d2a31cfbaf test-data/bowtie_out3.sam --- a/test-data/bowtie_out3.sam Tue Jan 12 15:48:21 2010 -0500 +++ b/test-data/bowtie_out3.sam Tue Jan 12 16:49:02 2010 -0500 @@ -1,2 +1,2 @@ -869_1532_1255 163 chrM 3727 255 27M = 3752 50 GGAAATATGTCTGACAAAAGAGTTACT !!PTUVYQPSUSNSRTXTSVYVRVX<! XA:i:2 MD:Z:27 NM:i:0 CM:i:2 -869_1532_1255 83 chrM 3752 255 25M = 3727 -50 CTTTGATAGAGTAAAACATAGAGGC >USVY_UOXZWRQRSUY[^XQR!! XA:i:1 MD:Z:25 NM:i:0 CM:i:1 +869_1532_1255 179 chrM 3727 255 25M = 3752 50 GGAAATATGTCTGACAAAAGAGTTA !!RVYVSTXTRSNSUSPQYVUTPR; XA:i:1 MD:Z:25 NM:i:0 CM:i:1 +869_1532_1255 115 chrM 3752 255 25M = 3727 -50 CTTTGATAGAGTAAAACATAGAGGC >USVY_UOXZWRQRSUY[^XQR!! XA:i:1 MD:Z:25 NM:i:0 CM:i:1 diff -r b78de785df21 -r 35d2a31cfbaf test-data/bowtie_out7.sam --- a/test-data/bowtie_out7.sam Tue Jan 12 15:48:21 2010 -0500 +++ b/test-data/bowtie_out7.sam Tue Jan 12 16:49:02 2010 -0500 @@ -1,2 +1,2 @@ -869_1532_1255 163 chrM 3728 255 25M = 3752 47 GAAATATGTCTGACAAAAGAGTTAC !PTUVYQPSUSNSRTXTSVYVRVX< XA:i:2 MD:Z:25 NM:i:0 CM:i:2 -869_1532_1255 83 chrM 3753 255 23M = 3727 -49 TTTGATAGAGTAAAACATAGAGG USVY_UOXZWRQRSUY[^XQR! XA:i:1 MD:Z:23 NM:i:0 CM:i:1 +869_1532_1255 77 * 0 0 * * 0 0 CAGGGTTCCAAATCGGGTTGCAAG =;8:?@=?;;9:8;=>;5A?;<8> XM:i:0 +869_1532_1255 141 * 0 0 * * 0 0 TACGGGAAACCGCGGCCTTTAAGG ;89<:==5<8>69;8=<9;<>9:= XM:i:0 diff -r b78de785df21 -r 35d2a31cfbaf tool_conf.xml.sample --- a/tool_conf.xml.sample Tue Jan 12 15:48:21 2010 -0500 +++ b/tool_conf.xml.sample Tue Jan 12 16:49:02 2010 -0500 @@ -192,6 +192,7 @@ <section name="NGS: Mapping" id="solexa_tools"> <tool file="sr_mapping/lastz_wrapper.xml" /> <tool file="sr_mapping/bowtie_wrapper.xml" /> + <tool file="sr_mapping/bowtie_color_wrapper.xml" /> <tool file="sr_mapping/bwa_wrapper.xml" /> <tool file="metag_tools/megablast_wrapper.xml" /> <tool file="metag_tools/megablast_xml_parser.xml" /> diff -r b78de785df21 -r 35d2a31cfbaf tools/sr_mapping/bowtie_color_wrapper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/sr_mapping/bowtie_color_wrapper.xml Tue Jan 12 16:49:02 2010 -0500 @@ -0,0 +1,659 @@ +<tool id="bowtie_color_wrapper" name="Map with Bowtie for SOLiD" version="1.0.0"> + <description></description> + <command interpreter="python"> + bowtie_wrapper.py + --threads="4" + --dataType="solid" + --output=$output + --suppressHeader=$suppressHeader + --genomeSource=$refGenomeSource.genomeSource + #if $refGenomeSource.genomeSource == "history": + --ref=$refGenomeSource.ownFile + --dbkey=$dbkey + --indexSettings=$refGenomeSource.indexParams.indexSettings + #if $refGenomeSource.indexParams.indexSettings == "indexFull": + --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB + #if $refGenomeSource.indexParams.autoBehavior.autoB == "set": + --ipacked=$refGenomeSource.indexParams.autoBehavior.packed + --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax + --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn + --idcv=$refGenomeSource.indexParams.autoBehavior.dcv + #else: + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + #end if + --inodc=$refGenomeSource.indexParams.nodc + --inoref=$refGenomeSource.indexParams.noref + --ioffrate=$refGenomeSource.indexParams.offrate + --iftab=$refGenomeSource.indexParams.ftab + --intoa=$refGenomeSource.indexParams.ntoa + --iendian=$refGenomeSource.indexParams.endian + --iseed=$refGenomeSource.indexParams.seed + --icutoff=$refGenomeSource.indexParams.cutoff + #else: + --iautoB="None" + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + --inodc="None" + --inoref="None" + --ioffrate="None" + --iftab="None" + --intoa="None" + --iendian="None" + --iseed="None" + --icutoff="None" + #end if + #else: + --ref=$refGenomeSource.index.value + --dbkey="None" + --indexSettings="None" + --iautoB="None" + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + --inodc="None" + --inoref="None" + --ioffrate="None" + --iftab="None" + --intoa="None" + --iendian="None" + --iseed="None" + --icutoff="None" + #end if + --paired=$singlePaired.sPaired + #if $singlePaired.sPaired == "single": + --input1=$singlePaired.sInput1 + --input2="None" + --params=$singlePaired.sParams.sSettingsType + #if $singlePaired.sParams.sSettingsType == "full": + --skip=$singlePaired.sParams.sSkip + --alignLimit=$singlePaired.sParams.sAlignLimit + --trimH=$singlePaired.sParams.sTrimH + --trimL=$singlePaired.sParams.sTrimL + --mismatchSeed=$singlePaired.sParams.sMismatchSeed + --mismatchQual=$singlePaired.sParams.sMismatchQual + --seedLen=$singlePaired.sParams.sSeedLen + --rounding=$singlePaired.sParams.sRounding + --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign + --tryHard=$singlePaired.sParams.sTryHard + --valAlign=$singlePaired.sParams.sValAlign + --allValAligns=$singlePaired.sParams.sAllValAligns + --suppressAlign=$singlePaired.sParams.sSuppressAlign + --best=$singlePaired.sParams.sBestOption.sBest + #if $singlePaired.sParams.sBestOption.sBest == "doBest": + --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks + --strata=$singlePaired.sParams.sBestOption.sdStrata + #else: + --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks + --strata="None" + #end if + --offrate=$singlePaired.sParams.sOffrate + --seed=$singlePaired.sParams.sSeed + --snpphred=$singlePaired.sParams.sSnpphred + --snpfrac=$singlePaired.sParams.sSnpfrac + --keepends=$singlePaired.sParams.sKeepends + #else: + --skip="None" + --alignLimit="None" + --trimH="None" + --trimL="None" + --mismatchSeed="None" + --mismatchQual="None" + --seedLen="None" + --rounding="None" + --maqSoapAlign="None" + --tryHard="None" + --valAlign="None" + --allValAligns="None" + --suppressAlign="None" + --best="None" + --maxBacktracks="None" + --strata="None" + --offrate="None" + --seed="None" + --snpphred="None" + --snpfrac="None" + --keepends="None" + #end if + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + #else: + --input1=$singlePaired.pInput1 + --input2=$singlePaired.pInput2 + --params=$singlePaired.pParams.pSettingsType + #if $singlePaired.pParams.pSettingsType == "full": + --skip=$singlePaired.pParams.pSkip + --alignLimit=$singlePaired.pParams.pAlignLimit + --trimH=$singlePaired.pParams.pTrimH + --trimL=$singlePaired.pParams.pTrimL + --mismatchSeed=$singlePaired.pParams.pMismatchSeed + --mismatchQual=$singlePaired.pParams.pMismatchQual + --seedLen=$singlePaired.pParams.pSeedLen + --rounding=$singlePaired.pParams.pRounding + --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign + --minInsert=$singlePaired.pParams.pMinInsert + --maxInsert=$singlePaired.pParams.pMaxInsert + --mateOrient=$singlePaired.pParams.pMateOrient + --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt + --forwardAlign=$singlePaired.pParams.pForwardAlign + --reverseAlign=$singlePaired.pParams.pReverseAlign + --tryHard=$singlePaired.pParams.pTryHard + --valAlign=$singlePaired.pParams.pValAlign + --allValAligns=$singlePaired.pParams.pAllValAligns + --suppressAlign=$singlePaired.pParams.pSuppressAlign + --best=$singlePaired.pParams.pBestOption.pBest + #if $singlePaired.pParams.pBestOption.pBest == "doBest": + --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks + --strata=$singlePaired.pParams.pBestOption.pdStrata + #else: + --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks + --strata="None" + #end if + --offrate=$singlePaired.pParams.pOffrate + --seed=$singlePaired.pParams.pSeed + --snpphred=$singlePaired.pParams.pSnpphred + --snpfrac=$singlePaired.pParams.pSnpfrac + --keepends=$singlePaired.pParams.pKeepends + #else: + --skip="None" + --alignLimit="None" + --trimH="None" + --trimL="None" + --mismatchSeed="None" + --mismatchQual="None" + --seedLen="None" + --rounding="None" + --maqSoapAlign="None" + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + --tryHard="None" + --valAlign="None" + --allValAligns="None" + --suppressAlign="None" + --best="None" + --maxBacktracks="None" + --strata="None" + --offrate="None" + --seed="None" + --snpphred="None" + --snpfrac="None" + --keepends="None" + #end if + #end if + </command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select the reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="bowtie_indices_color.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + </options> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + <conditional name="indexParams"> + <param name="indexSettings" type="select" label="Choose whether to use default options for building indices or to set your own"> + <option value="indexPreSet">Default</option> + <option value="indexFull">Set your own</option> + </param> + <when value="indexPreSet" /> + <when value="indexFull"> + <conditional name="autoBehavior"> + <param name="autoB" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv"> + <option value="auto">Automatic behavior</option> + <option value="set">Set values (sets --noauto and allows others to be set)</option> + </param> + <when value="auto" /> + <when value="set"> + <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)"> + <option value="unpacked">Use regular representation</option> + <option value="packed">Use packed representation</option> + </param> + <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" /> + <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" /> + <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" /> + </when> + </conditional> + <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetitive reference)"> + <option value="dc">Use difference-cover sample</option> + <option value="nodc">Disable difference-cover sample</option> + </param> + <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)"> + <option value="ref">Build all index files</option> + <option value="noref">Do not build paired-end alignment index files</option> + </param> + <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" /> + <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" /> + <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)"> + <option value="no">Do not convert Ns</option> + <option value="yes">Convert Ns to As</option> + </param> + <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture"> + <option value="little">Little</option> + <option value="big">Big</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> + <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> + </when> <!-- cIndexFull --> + </conditional> <!-- cIndexParams --> + </when> <!-- cHistory --> + </conditional> <!-- cRefGenomeSource --> + <conditional name="singlePaired"> + <param name="sPaired" type="select" label="Is this library mate-paired?"> + <option value="single">Single-end</option> + <option value="paired">Paired-end</option> + </param> + <when value="single"> + <param name="sInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <conditional name="sParams"> + <param name="sSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet" /> + <when value="full"> + <param name="sSkip" type="integer" value="0" label="Skip the first n reads (-s)" /> + <param name="sAlignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" /> + <param name="sTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="sTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="sMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="sMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="sSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="sRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="sMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="sTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="sValAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" /> + <param name="sAllValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="sSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <conditional name="sBestOption"> + <param name="sBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="snMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + </when> + <when value="doBest"> + <param name="sdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="sdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> + </param> + </when> + </conditional> <!-- csBestOption --> + <param name="sOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> + <param name="sSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + <param name="sSnpphred" type="integer" value="-1" label="SNP penalty (ratio of SNPs per base in the subject genome) (--snpphred)" help="Enter this OR Ratio of SNPs per base" /> + <param name="sSnpfrac" type="float" value="0.001" label="Ratio of SNPs per base (estimated ratio for colorspace alignments) (--snpfrac)" help="Enter this OR SNP penalty" /> + <param name="sKeepends" type="select" label="Keep the extreme-ends nucleotides and qualities rather than trimming them (--keepends)"> + <option value="doKeepends">Keep ends</option> + <option value="noKeepends">Trim ends</option> + </param> + </when> <!-- csFull --> + </conditional> <!-- csParams --> + </when> <!-- cSingle --> + <when value="paired"> + <param name="pInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="pInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <conditional name="pParams"> + <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet" /> + <when value="full"> + <param name="pSkip" type="integer" value="0" label="Skip the first n pairs (-s)" /> + <param name="pAlignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" /> + <param name="pTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="pTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="pMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="pMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="pSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="pRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="pMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="pMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> + <param name="pMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> + <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> + <option value="ff">FF (for SOLiD)</option> + <option value="fr">FR (for Illumina)</option> + <option value="rf">RF</option> + </param> + <param name="pMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> + <param name="pForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> + <option value="forward">Align against the forward reference strand</option> + <option value="noForward">Do not align against the forward reference strand</option> + </param> + <param name="pReverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)"> + <option value="reverse">Align against the reverse-complement reference strand</option> + <option value="noReverse">Do not align against the reverse-complement reference strand</option> + </param> + <param name="pTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="pValAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" /> + <param name="pAllValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="pSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <conditional name="pBestOption"> + <param name="pBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="pnMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + </when> + <when value="doBest"> + <param name="pdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="pdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> + </param> + </when> + </conditional> <!-- cpBestOption --> + <param name="pOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> + <param name="pSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + <param name="pSnpphred" type="integer" value="-1" label="SNP penalty (ratio of SNPs per base in the subject genome) (--snpphred)" help="Enter this OR Ratio of SNPs per base" /> + <param name="pSnpfrac" type="float" value="0.001" label="Ratio of SNPs per base (estimated ratio for colorspace alignments) (--snpfrac)" help="Enter this OR SNP penalty" /> + <param name="pKeepends" type="select" label="Keep the extreme-ends nucleotides and qualities rather than trimming them (--keepends)"> + <option value="doKeepends">Keep ends</option> + <option value="noKeepends">Trim ends</option> + </param> + </when> <!-- cpFull --> + </conditional> <!-- cpParams --> + </when> <!-- cPaired --> + </conditional> <!-- cSinglePaired --> + <param name="suppressHeader" type="boolean" truevalue="true" falsevalue="false" checked="true" label="Suppress the header in the output SAM file" help="Bowtie produces SAM with several lines of header information" /> + </inputs> + <outputs> + <data format="sam" name="output" /> + </outputs> + <tests> + <test> + <!-- + Bowtie command: + bowtie -p 4 -S +sam-nohead -q -C chrM_color test-data/bowtie_in1.fastqsanger > test-data/bowtie_out1.sam + -p is the number of threads, which is hardcoded above. You need to replace the + with 2 dashes. + chrM_color needs to be the base location/name of the index files. + --> + <param name="genomeSource" value="indexed" /> + <param name="index" value="equCab2chrM" /> + <param name="sPaired" value="single" /> + <param name="sInput1" ftype="fastqsanger" value="bowtie_in1.fastqsanger" /> + <param name="sSettingsType" value="preSet" /> + <param name="suppressHeader" value="true" /> + <output name="output" ftype="sam" file="bowtie_out1.sam" /> + </test> + <test> + <!-- + Bowtie command: + bowtie-build -f -C test-data/chr_m.fasta chrM_color + bowtie -n 2 -e 70 -l 28 -X 250 +ff +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam + -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. + chrM_base is the index files' location/base name. + --> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chr_m.fasta" /> + <param name="indexSettings" value="indexPreSet" /> + <param name="sPaired" value="paired" /> + <param name="pInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" /> + <param name="pInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" /> + <param name="pSettingsType" value="full" /> + <param name="pSkip" value="0" /> + <param name="pAlignLimit" value="-1" /> + <param name="pTrimH" value="0" /> + <param name="pTrimL" value="0" /> + <param name="pMismatchSeed" value="2" /> + <param name="pMismatchQual" value="70" /> + <param name="pSeedLen" value="28" /> + <param name="pRounding" value="round" /> + <param name="pMaqSoapAlign" value="-1" /> + <param name="pMinInsert" value="0" /> + <param name="pMaxInsert" value="250" /> + <param name="pMateOrient" value="ff" /> + <param name="pMaxAlignAttempt" value="100" /> + <param name="pForwardAlign" value="forward" /> + <param name="pReverseAlign" value="reverse" /> + <param name="pTryHard" value="noTryHard" /> + <param name="pValAlign" value="1" /> + <param name="pAllValAligns" value="noAllValAligns" /> + <param name="pSuppressAlign" value="-1" /> + <param name="pBest" value="noBest" /> + <param name="pnMaxBacktracks" value="125" /> + <param name="pOffrate" value="-1" /> + <param name="pSeed" value="-1" /> + <param name="pSnpphred" value="-1" /> + <param name="pSnpfrac" value="0.001" /> + <param name="pKeepends" value="doKeepends" /> + <param name="suppressHeader" value="true" /> + <output name="output" ftype="sam" file="bowtie_out3.sam" /> + </test> + <test> + <!-- + Bowtie command: + bowtie -n 2 -e 70 -l 28 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color test-data/bowtie_in1.fastqsanger > test-data/bowtie_out5.sam + -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. + chrM_base is the index files' location/base name. + --> + <param name="genomeSource" value="indexed" /> + <param name="index" value="equCab2chrM" /> + <param name="sPaired" value="single" /> + <param name="sInput1" ftype="fastqsanger" value="bowtie_in1.fastqsanger" /> + <param name="sSettingsType" value="full" /> + <param name="sSkip" value="0" /> + <param name="sAlignLimit" value="-1" /> + <param name="sTrimH" value="0" /> + <param name="sTrimL" value="0" /> + <param name="sMismatchSeed" value="2" /> + <param name="sMismatchQual" value="70" /> + <param name="sSeedLen" value="28" /> + <param name="sRounding" value="round" /> + <param name="sMaqSoapAlign" value="-1" /> + <param name="sTryHard" value="noTryHard" /> + <param name="sValAlign" value="1" /> + <param name="sAllValAligns" value="noAllValAligns" /> + <param name="sSuppressAlign" value="-1" /> + <param name="sBest" value="noBest" /> + <param name="snMaxBacktracks" value="125" /> + <param name="sOffrate" value="-1" /> + <param name="sSeed" value="-1" /> + <param name="sSnpphred" value="-1" /> + <param name="sSnpfrac" value="0.001" /> + <param name="sKeepends" value="doKeepends" /> + <param name="suppressHeader" value="true" /> + <output name="output" ftype="sam" file="bowtie_out5.sam" /> + </test> + <test> + <!-- + Bowtie command: + bowtie-build +noauto +bmaxdivn 4 +dcv 1024 +offrate 5 +ftabchars 10 +little -C -f test-data/chr_m.fasta chrM_color + bowtie -p 4 -S +sam-nohead -q -C chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out7.sam + -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. + chrM_base is the index files' location/base name. + --> + <param name="genomeSource" value="cHistory" /> + <param name="ownFile" value="chr_m.fasta" /> + <param name="indexSettings" value="indexFull" /> + <param name="autoB" value="set" /> + <param name="packed" value="unpacked" /> + <param name="bmax" value="-1" /> + <param name="bmaxdivn" value="4" /> + <param name="dcv" value="1024" /> + <param name="nodc" value="dc" /> + <param name="noref" value="ref" /> + <param name="offrate" value="5" /> + <param name="ftab" value="10" /> + <param name="ntoa" value="no" /> + <param name="endian" value="little" /> + <param name="seed" value="-1" /> + <param name="cutoff" value="-1" /> + <param name="sPaired" value="paired" /> + <param name="pInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" /> + <param name="pInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" /> + <param name="pSettingsType" value="preSet" /> + <param name="suppressHeader" value="true" /> + <output name="output" ftype="sam" file="bowtie_out7.sam" /> + </test> + </tests> + + <help> + +**What it does** + +Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. Please cite: Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25. + +.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml + +------ + +**Know what you are doing** + +.. class:: warningmark + +There is no such thing (yet) as automated gearshift in short read mapping. It is all like stick-shift driving in San Francisco. In other words = running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to **understand** the parameters by carefully reading `documentation`__ and experimenting. Fortunaly, Galaxy makes experimenting easy. + + .. __: http://bowtie-bio.sourceforge.net/index.shtml + +------ + +**Input formats** + +Bowtie accepts files in Sanger FASTQ format. + +------ + +**Outputs** + +The output is in SAM format, and has the following columns:: + + Column Description + -------- -------------------------------------------------------- + 1 QNAME Query (pair) NAME + 2 FLAG bitwise FLAG + 3 RNAME Reference sequence NAME + 4 POS 1-based leftmost POSition/coordinate of clipped sequence + 5 MAPQ MAPping Quality (Phred-scaled) + 6 CIGAR extended CIGAR string + 7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME) + 8 MPOS 1-based Mate POSition + 9 ISIZE Inferred insert SIZE + 10 SEQ query SEQuence on the same strand as the reference + 11 QUAL query QUALity (ASCII-33 gives the Phred base quality) + 12 OPT variable OPTional fields in the format TAG:VTYPE:VALUE + +The flags are as follows:: + + Flag Description + ------ ------------------------------------- + 0x0001 the read is paired in sequencing + 0x0002 the read is mapped in a proper pair + 0x0004 the query sequence itself is unmapped + 0x0008 the mate is unmapped + 0x0010 strand of the query (1 for reverse) + 0x0020 strand of the mate + 0x0040 the read is the first read in a pair + 0x0080 the read is the second read in a pair + 0x0100 the alignment is not primary + +It looks like this (scroll sideways to see the entire example):: + + QNAME FLAG RNAME POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL OPT + HWI-EAS91_1_30788AAXX:1:1:1761:343 4 * 0 0 * * 0 0 AAAAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAACNNANNGAGTNGNNNNNNNGCTTCCCACAGNNCTGG hhhhhhh;;hhhhhhhhhhh^hOhhhhghhhfhhhgh;;h;;hhhh;h;;;;;;;hhhhhhghhhh;;Phhh + HWI-EAS91_1_30788AAXX:1:1:1578:331 4 * 0 0 * * 0 0 GTATAGANNAATAAGAAAAAAAAAAATGAAGACTTTCNNANNTCTGNANNNNNNNTCTTTTTTCAGNNGTAG hhhhhhh;;hhhhhhhhhhhhhhhhhhhhhhhhhhhh;;h;;hhhh;h;;;;;;;hhhhhhhhhhh;;hhVh + +------- + +**Bowtie settings** + +All of the options have a default value. You can change any of them. Most of the options in Bowtie have been implemented here. + +------ + +**Bowtie parameter list** + +This is an exhaustive list of Bowtie options: + +For indexing (bowtie-build):: + -a No auto behavior. Disable the default behavior where bowtie automatically selects values for --bmax/--dcv/--packed parameters according to the memory available. [off] + -p Packing. Use a packed representation for DNA strings. [auto] + --bmax <int> Suffix maximum. The maximum number of suffixes allowed in a block. [auto] + --bmaxdivn <int> Suffix maximum fraction. The maximum number of suffixes allowed in a block expressed as a fraction of the length of the reference. [4] + --dcv <int> Difference-cover sample. Use <int> as the period for the difference-cover sample. [1024] + --nodc <int> No difference-cover sample. Disable the difference-cover sample. [off] + -r No reference indexes. Do not build the NAME.3.ebwt and NAME.4.ebwt portions of the index, used only for paired-end alignment. [off] + -o Offrate. How many Burrows-Wheeler rows get marked by the indexer. The indexer will mark every 2^<int> rows. The marked rows correspond to rows on the genome. [5] + -t <int> Ftab. The lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. Ftab is 4^<int>+1 bytes. [10] + --ntoa N conversion. Convert Ns to As before building the index. Otherwise, Ns are simply excluded from the index and Bowtie will not find alignments that overlap them. [off] + --big Endianness. Endianness to use when serializing integers to the index file. [off] + --little Endianness. [--little] + --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] + --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off] + +For aligning (bowtie):: + -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off] + -u <int> Align limit. Only align the first <int> reads/pairs from the input. [no limit] + -5 <int> High-quality trim. Trim <int> bases from the high-quality (left) end of each read before alignment. [0] + -3 <int> Low-quality trim. Trim <int> bases from the low-quality (right) end of each read before alignment. [0] + -n <int> Mismatch seed. Maximum number of mismatches permitted in the seed (defined with seed length option). Can be 0, 1, 2, or 3. [2] + -e <int> Mismatch quality. Maximum permitted total of quality values at mismatched read positions. Bowtie rounds quality values to the nearest 10 and saturates at 30. [70] + -l <int> Seed length. The number of bases on the high-quality end of the read to which the -n ceiling applies. Must be at least 5. [28] + --nomaqround Suppress MAQ rounding. Values are internally rounded to the nearest 10 and saturate at 30. This options turns off that rounding. [off] + -v <int> MAQ- or SOAP-like alignment policy. This option turns off the default MAQ-like alignment policy in favor of a SOAP-like one. End-to-end alignments with at most <int> mismatches. [off] + -I <int> Minimum insert. The minimum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [0] + --fr Mate orientation. The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. [--fr] + --rf Mate orientation. [off] + --ff Mate orientation. [off] + -X <int> Maximum insert. The maximum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [250] + --pairtries <int> Maximum alignment attempts for paired-end data. [100] + --nofw No forward aligning. Choosing this option means that Bowtie will not attempt to align against the forward reference strand. [off] + --norc No reverse-complement aligning. Setting this will mean that Bowtie will not attempt to align against the reverse-complement reference strand. [off] + --maxbts <int> Maximum backtracks. The maximum number of backtracks permitted when aligning a read in -n 2 or -n 3 mode. [125 without --best] [800 with --best] + -y Try hard. Try as hard as possible to find valid alignments when they exist, including paired-end alignments. [off] + --chunkmbs <int> Thread memory. The number of megabytes of memory a given thread is given to store path descriptors in --best mode. [32] + -k <int> Valid alignments. The number of valid alignments per read or pair. [off] + -a All valid alignments. Choosing this means that all valid alignments per read or pair will be reported. [off] + -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit] + --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off] + --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off] + -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off] + --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] + --snpphred <int> Use <int> as the SNP penalty for decoding colorspace alignments. True ratio of SNPs per base in the subject genome. [see --snpfrac] + --snpfrac <dec> Use <dec> as the estimated ratio of SNPs per base when decoding colorspace alignments. [0.001] + --col-keepends Keep the extreme-end nucleotides and qualities when decoding colorspace alignments. [off] + + </help> + <code file="bowtie_wrapper_code.py" /> +</tool> diff -r b78de785df21 -r 35d2a31cfbaf tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Tue Jan 12 15:48:21 2010 -0500 +++ b/tools/sr_mapping/bowtie_wrapper.py Tue Jan 12 16:49:02 2010 -0500 @@ -42,7 +42,7 @@ -S, --seed=S: Seed for pseudo-random number generator -d, --dbkey=d: Dbkey of reference genome -C, --params=C: Whether to use default or specified parameters - -u, --iauto_b=u: Automatic or specified behavior + -u, --iautoB=u: Automatic or specified behavior -K, --ipacked=K: Whether or not to use a packed representation for DNA strings -Q, --ibmax=Q: Maximum number of suffixes allowed in a block -Y, --ibmaxdivn=Y: Maximum number of suffixes allowed in a block as a fraction of the length of the reference @@ -105,7 +105,7 @@ parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' ) parser.add_option( '-d', '--dbkey', dest='dbkey', help='Dbkey of reference genome' ) parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' ) - parser.add_option( '-u', '--iauto_b', dest='iauto_b', help='Automatic or specified behavior' ) + parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' ) parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' ) parser.add_option( '-Q', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block' ) parser.add_option( '-Y', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference' ) @@ -129,17 +129,17 @@ else: colorspace = '' # index if necessary - if options.genomeSource == 'cHistory' or options.genomeSource == 'xHistory': + if options.genomeSource == 'history': # set up commands - if options.index_settings =='cIndexPreSet' or options.index_settings == 'xIndexPreSet': + if options.index_settings =='indexPreSet': indexing_cmds = '%s' % colorspace else: try: - if options.iauto_b == 'set': - iauto_b = '--noauto' + if options.iautoB != 'None' and options.iautoB == 'set': + iautoB = '--noauto' else: - iauto_b = '' - if options.ipacked == 'packed': + iautoB = '' + if options. ipacked != 'None' and options.ipacked == 'packed': ipacked = '--packed' else: ipacked = '' @@ -155,11 +155,11 @@ idcv = '--dcv %s' % options.idcv else: idcv = '' - if options.inodc == 'nodc': + if options.inodc != 'None' and options.inodc == 'nodc': inodc = '--nodc' else: inodc = '' - if options.inoref == 'noref': + if options.inoref != 'None' and options.inoref == 'noref': inoref = '--noref' else: inoref = '' @@ -167,24 +167,24 @@ iftab = '--ftabchars %s' % options.iftab else: iftab = '' - if options.intoa == 'yes': + if options.intoa != 'None' and options.intoa == 'yes': intoa = '--ntoa' else: intoa = '' - if options.iendian == 'big': + if options.iendian != 'None' and options.iendian == 'big': iendian = '--big' else: iendian = '--little' - if int( options.iseed ) > 0: + if options.iseed != 'None' and int( options.iseed ) > 0: iseed = '--seed %s' % options.iseed else: iseed = '' - if int( options.icutoff ) > 0: + if options.icutoff != 'None' and int( options.icutoff ) > 0: icutoff = '--cutoff %s' % options.icutoff else: icutoff = '' indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ - ( iauto_b, ipacked, ibmax, ibmaxdivn, idcv, inodc, + ( iautoB, ipacked, ibmax, ibmaxdivn, idcv, inodc, inoref, options.ioffrate, iftab, intoa, iendian, iseed, icutoff, colorspace ) except ValueError: @@ -206,8 +206,7 @@ suppressHeader = '--sam-nohead' else: suppressHeader = '' - if options.params == 'csPreSet' or options.params == 'cpPreSet' or \ - options.params == 'xsPreSet' or options.params == 'xpPreSet': + if options.params == 'preSet': aligning_cmds = '-p %s -S %s -q %s ' % ( options.threads, suppressHeader, colorspace ) else: try: @@ -215,27 +214,28 @@ skip = '-s %s' % options.skip else: skip = '' - if int( options.alignLimit ) >= 0: + if options.alignLimit != 'None' and int( options.alignLimit ) >= 0: alignLimit = '-u %s' % options.alignLimit else: alignLimit = '' - if int( options.trimH ) > 0: + if options.trimH != 'None' and int( options.trimH ) > 0: trimH = '-5 %s' % options.trimH else: trimH = '' - if int( options.trimL ) > 0: + if options.trimL != 'None' and int( options.trimL ) > 0: trimL = '-3 %s' % options.trimL else: trimL = '' - if options.mismatchSeed == '0' or options.mismatchSeed == '1' or options.mismatchSeed == '2' or options.mismatchSeed == '3': + if options. mismatchSeed != 'None' and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \ + or options.mismatchSeed == '2' or options.mismatchSeed == '3'): mismatchSeed = '-n %s' % options.mismatchSeed else: mismatchSeed = '' - if int( options.mismatchQual ) >= 0: + if options.mismatchQual != 'None' and int( options.mismatchQual ) >= 0: mismatchQual = '-e %s' % options.mismatchQual else: mismatchQual = '' - if int( options.seedLen ) >= 5: + if options.seedLen != 'None' and int( options.seedLen ) >= 5: seedLen = '-l %s' % options.seedLen else: seedLen = '' @@ -292,8 +292,7 @@ suppressAlign = '-m %s' % options.suppressAlign else: suppressAlign = '' - if options.best == 'csDoBest' or options.best == 'cpDoBest' or \ - options.best == 'xsDoBest' or options.best == 'xpDoBest': + if options.best == 'doBest': best = '--best' else: best = '' @@ -332,7 +331,7 @@ except ValueError, e: stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) ) # prepare actual aligning commands - if options.paired == 'cPaired' or options.paired == 'xPaired': + if options.paired == 'paired': cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % ( aligning_cmds, options.ref, options.input1, options.input2, options.output ) else: cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % ( aligning_cmds, options.ref, options.input1, options.output ) diff -r b78de785df21 -r 35d2a31cfbaf tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Tue Jan 12 15:48:21 2010 -0500 +++ b/tools/sr_mapping/bowtie_wrapper.xml Tue Jan 12 16:49:02 2010 -0500 @@ -1,780 +1,383 @@ -<tool id="bowtie_wrapper" name="Map with Bowtie" version="1.0.5"> +<tool id="bowtie_wrapper" name="Map with Bowtie for Illumina" version="1.0.6"> <description></description> <command interpreter="python"> - bowtie_wrapper.py --threads="4" --output=$output --suppressHeader=$suppressHeader --dataType=$solidOrSolexa.dataType -#if $solidOrSolexa.dataType == "solid": - --genomeSource=$solidOrSolexa.cRefGenomeSource.cGenomeSource - #if $solidOrSolexa.cRefGenomeSource.cGenomeSource == "cIndexed": - --ref=$solidOrSolexa.cRefGenomeSource.cIndex.value - --dbkey="None" - --indexSettings="None" - --iauto_b="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" - #else: - --ref=$solidOrSolexa.cRefGenomeSource.cOwnFile - --dbkey=$dbkey - --indexSettings=$solidOrSolexa.cRefGenomeSource.cIndexParams.cIndexSettings - #if $solidOrSolexa.cRefGenomeSource.cIndexParams.cIndexSettings == "cIndexFull": - --iauto_b=$solidOrSolexa.cRefGenomeSource.cIndexParams.cAutoBehavior.cAutoB == "cSet" - #if $solidOrSolexa.cRefGenomeSource.cIndexParams.cAutoBehavior.cAutoB == "cSet": - --ipacked=$solidOrSolexa.cRefGenomeSource.cIndexParams.cAutoBehavior.cPacked - --ibmax=$solidOrSolexa.cRefGenomeSource.cIndexParams.cAutoBehavior.cBmax - --ibmaxdivn=$solidOrSolexa.cRefGenomeSource.cIndexParams.cAutoBehavior.cBmaxdivn - --idcv=$solidOrSolexa.cRefGenomeSource.cIndexParams.cAutoBehavior.cDcv - #else: - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - #end if - --inodc=$solidOrSolexa.cRefGenomeSource.cIndexParams.cNodc - --inoref=$solidOrSolexa.cRefGenomeSource.cIndexParams.cNoref - --ioffrate=$solidOrSolexa.cRefGenomeSource.cIndexParams.cOffrate - --iftab=$solidOrSolexa.cRefGenomeSource.cIndexParams.cFtab - --intoa=$solidOrSolexa.cRefGenomeSource.cIndexParams.cNtoa - --iendian=$solidOrSolexa.cRefGenomeSource.cIndexParams.cEndian - --iseed=$solidOrSolexa.cRefGenomeSource.cIndexParams.cSeed - --icutoff=$solidOrSolexa.cRefGenomeSource.cIndexParams.cCutoff - #else: - --iauto_b="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" - #end if - #end if - --paired=$solidOrSolexa.cSinglePaired.cSPaired - #if $solidOrSolexa.cSinglePaired.cSPaired == "cSingle": - --input1=$solidOrSolexa.cSinglePaired.csInput1 - --input2="None" - --params=$solidOrSolexa.cSinglePaired.csParams.csSettingsType - #if $solidOrSolexa.cSinglePaired.csParams.csSettingsType == "csFull": - --skip=$solidOrSolexa.cSinglePaired.csParams.csSkip - --alignLimit=$solidOrSolexa.cSinglePaired.csParams.csAlignLimit - --trimH=$solidOrSolexa.cSinglePaired.csParams.csTrimH - --trimL=$solidOrSolexa.cSinglePaired.csParams.csTrimL - --mismatchSeed=$solidOrSolexa.cSinglePaired.csParams.csMismatchSeed - --mismatchQual=$solidOrSolexa.cSinglePaired.csParams.csMismatchQual - --seedLen=$solidOrSolexa.cSinglePaired.csParams.csSeedLen - --rounding=$solidOrSolexa.cSinglePaired.csParams.csRounding - --maqSoapAlign=$solidOrSolexa.cSinglePaired.csParams.csMaqSoapAlign - --tryHard=$solidOrSolexa.cSinglePaired.csParams.csTryHard - --valAlign=$solidOrSolexa.cSinglePaired.csParams.csValAlign - --allValAligns=$solidOrSolexa.cSinglePaired.csParams.csAllValAligns - --suppressAlign=$solidOrSolexa.cSinglePaired.csParams.csSuppressAlign - --best=$solidOrSolexa.cSinglePaired.csParams.csBestOption.csBest - #if $solidOrSolexa.cSinglePaired.csParams.csBestOption.csBest == "csDoBest": - --maxBacktracks=$solidOrSolexa.cSinglePaired.csParams.csBestOption.csdMaxBacktracks - --strata=$solidOrSolexa.cSinglePaired.csParams.csBestOption.csdStrata - #else: - --maxBacktracks=$solidOrSolexa.cSinglePaired.csParams.csBestOption.csnMaxBacktracks - --strata="None" - #end if - --offrate=$solidOrSolexa.cSinglePaired.csParams.csOffrate - --seed=$solidOrSolexa.cSinglePaired.csParams.csSeed - --snpphred=$solidOrSolexa.cSinglePaired.csParams.csSnpphred - --snpfrac=$solidOrSolexa.cSinglePaired.csParams.csSnpfrac - --keepends=$solidOrSolexa.cSinglePaired.csParams.csKeepends - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --snpphred="None" - --snpfrac="None" - --keepends="None" - #end if - --minInsert="None" - --maxInsert="None" - --mateOrient="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" - #else: - --input1=$solidOrSolexa.cSinglePaired.cpInput1 - --input2=$solidOrSolexa.cSinglePaired.cpInput2 - --params=$solidOrSolexa.cSinglePaired.cpParams.cpSettingsType - #if $solidOrSolexa.cSinglePaired.cpParams.cpSettingsType == "cpFull": - --skip=$solidOrSolexa.cSinglePaired.cpParams.cpSkip - --alignLimit=$solidOrSolexa.cSinglePaired.cpParams.cpAlignLimit - --trimH=$solidOrSolexa.cSinglePaired.cpParams.cpTrimH - --trimL=$solidOrSolexa.cSinglePaired.cpParams.cpTrimL - --mismatchSeed=$solidOrSolexa.cSinglePaired.cpParams.cpMismatchSeed - --mismatchQual=$solidOrSolexa.cSinglePaired.cpParams.cpMismatchQual - --seedLen=$solidOrSolexa.cSinglePaired.cpParams.cpSeedLen - --rounding=$solidOrSolexa.cSinglePaired.cpParams.cpRounding - --maqSoapAlign=$solidOrSolexa.cSinglePaired.cpParams.cpMaqSoapAlign - --minInsert=$solidOrSolexa.cSinglePaired.cpParams.cpMinInsert - --maxInsert=$solidOrSolexa.cSinglePaired.cpParams.cpMaxInsert - --mateOrient=$solidOrSolexa.cSinglePaired.cpParams.cpMateOrient - --maxAlignAttempt=$solidOrSolexa.cSinglePaired.cpParams.cpMaxAlignAttempt - --forwardAlign=$solidOrSolexa.cSinglePaired.cpParams.cpForwardAlign - --reverseAlign=$solidOrSolexa.cSinglePaired.cpParams.cpReverseAlign - --tryHard=$solidOrSolexa.cSinglePaired.cpParams.cpTryHard - --valAlign=$solidOrSolexa.cSinglePaired.cpParams.cpValAlign - --allValAligns=$solidOrSolexa.cSinglePaired.cpParams.cpAllValAligns - --suppressAlign=$solidOrSolexa.cSinglePaired.cpParams.cpSuppressAlign - --best=$solidOrSolexa.cSinglePaired.cpParams.cpBestOption.cpBest - #if $solidOrSolexa.cSinglePaired.cpParams.cpBestOption.cpBest == "cpDoBest": - --maxBacktracks=$solidOrSolexa.cSinglePaired.cpParams.cpBestOption.cpdMaxBacktracks - --strata=$solidOrSolexa.cSinglePaired.cpParams.cpBestOption.cpdStrata - #else: - --maxBacktracks=$solidOrSolexa.cSinglePaired.cpParams.cpBestOption.cpnMaxBacktracks - --strata="None" - #end if - --offrate=$solidOrSolexa.cSinglePaired.cpParams.cpOffrate - --seed=$solidOrSolexa.cSinglePaired.cpParams.cpSeed - --snpphred=$solidOrSolexa.cSinglePaired.cpParams.cpSnpphred - --snpfrac=$solidOrSolexa.cSinglePaired.cpParams.cpSnpfrac - --keepends=$solidOrSolexa.cSinglePaired.cpParams.cpKeepends - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --snpphred="None" - --snpfrac="None" - --keepends="None" - --minInsert="None" - --maxInsert="None" - --mateOrient="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" - #end if - #end if -#else: - --genomeSource=$solidOrSolexa.xRefGenomeSource.xGenomeSource - #if $solidOrSolexa.xRefGenomeSource.xGenomeSource == "xIndexed": - --ref=$solidOrSolexa.xRefGenomeSource.xIndex.value - --dbkey="None" - --indexSettings="None" - --iauto_b="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" - #else: - --ref=$solidOrSolexa.xRefGenomeSource.xOwnFile - --dbkey=$dbkey - --indexSettings=$solidOrSolexa.xRefGenomeSource.xIndexParams.xIndexSettings - #if $solidOrSolexa.xRefGenomeSource.xIndexParams.xIndexSettings == "xIndexFull": - --iauto_b=$solidOrSolexa.xRefGenomeSource.xIndexParams.xAutoBehavior.xAutoB == "xSet" - #if $solidOrSolexa.xRefGenomeSource.xIndexParams.xAutoBehavior.xAutoB == "xSet": - --ipacked=$solidOrSolexa.xRefGenomeSource.xIndexParams.xAutoBehavior.xPacked - --ibmax=$solidOrSolexa.xRefGenomeSource.xIndexParams.xAutoBehavior.xBmax - --ibmaxdivn=$solidOrSolexa.xRefGenomeSource.xIndexParams.xAutoBehavior.xBmaxdivn - --idcv=$solidOrSolexa.xRefGenomeSource.xIndexParams.xAutoBehavior.xDcv - #else: - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - #end if - --inodc=$solidOrSolexa.xRefGenomeSource.xIndexParams.xNodc - --inoref=$solidOrSolexa.xRefGenomeSource.xIndexParams.xNoref - --ioffrate=$solidOrSolexa.xRefGenomeSource.xIndexParams.xOffrate - --iftab=$solidOrSolexa.xRefGenomeSource.xIndexParams.xFtab - --intoa=$solidOrSolexa.xRefGenomeSource.xIndexParams.xNtoa - --iendian=$solidOrSolexa.xRefGenomeSource.xIndexParams.xEndian - --iseed=$solidOrSolexa.xRefGenomeSource.xIndexParams.xSeed - --icutoff=$solidOrSolexa.xRefGenomeSource.xIndexParams.xCutoff - #else: - --iauto_b="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" - #end if - #end if - --paired=$solidOrSolexa.xSinglePaired.xSPaired - #if $solidOrSolexa.xSinglePaired.xSPaired == "xSingle": - --input1=$solidOrSolexa.xSinglePaired.xsInput1 - --input2="None" - --params=$solidOrSolexa.xSinglePaired.xsParams.xsSettingsType - #if $solidOrSolexa.xSinglePaired.xsParams.xsSettingsType == "xsFull": - --skip=$solidOrSolexa.xSinglePaired.xsParams.xsSkip - --alignLimit=$solidOrSolexa.xSinglePaired.xsParams.xsAlignLimit - --trimH=$solidOrSolexa.xSinglePaired.xsParams.xsTrimH - --trimL=$solidOrSolexa.xSinglePaired.xsParams.xsTrimL - --mismatchSeed=$solidOrSolexa.xSinglePaired.xsParams.xsMismatchSeed - --mismatchQual=$solidOrSolexa.xSinglePaired.xsParams.xsMismatchQual - --seedLen=$solidOrSolexa.xSinglePaired.xsParams.xsSeedLen - --rounding=$solidOrSolexa.xSinglePaired.xsParams.xsRounding - --maqSoapAlign=$solidOrSolexa.xSinglePaired.xsParams.xsMaqSoapAlign - --tryHard=$solidOrSolexa.xSinglePaired.xsParams.xsTryHard - --valAlign=$solidOrSolexa.xSinglePaired.xsParams.xsValAlign - --allValAligns=$solidOrSolexa.xSinglePaired.xsParams.xsAllValAligns - --suppressAlign=$solidOrSolexa.xSinglePaired.xsParams.xsSuppressAlign - --best=$solidOrSolexa.xSinglePaired.xsParams.xsBestOption.xsBest - #if $solidOrSolexa.xSinglePaired.xsParams.xsBestOption.xsBest == "xsDoBest": - --maxBacktracks=$solidOrSolexa.xSinglePaired.xsParams.xsBestOption.xsdMaxBacktracks - --strata=$solidOrSolexa.xSinglePaired.xsParams.xsBestOption.xsdStrata - #else: - --maxBacktracks=$solidOrSolexa.xSinglePaired.xsParams.xsBestOption.xsnMaxBacktracks - --strata="None" - #end if - --offrate=$solidOrSolexa.xSinglePaired.xsParams.xsOffrate - --seed=$solidOrSolexa.xSinglePaired.xsParams.xsSeed - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - #end if - --snpphred="None" - --snpfrac="None" - --keepends="None" - --minInsert="None" - --maxInsert="None" - --mateOrient="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" - #else: - --input1=$solidOrSolexa.xSinglePaired.xpInput1 - --input2=$solidOrSolexa.xSinglePaired.xpInput2 - --params=$solidOrSolexa.xSinglePaired.xpParams.xpSettingsType - #if $solidOrSolexa.xSinglePaired.xpParams.xpSettingsType == "xpFull": - --skip=$solidOrSolexa.xSinglePaired.xpParams.xpSkip - --alignLimit=$solidOrSolexa.xSinglePaired.xpParams.xpAlignLimit - --trimH=$solidOrSolexa.xSinglePaired.xpParams.xpTrimH - --trimL=$solidOrSolexa.xSinglePaired.xpParams.xpTrimL - --mismatchSeed=$solidOrSolexa.xSinglePaired.xpParams.xpMismatchSeed - --mismatchQual=$solidOrSolexa.xSinglePaired.xpParams.xpMismatchQual - --seedLen=$solidOrSolexa.xSinglePaired.xpParams.xpSeedLen - --rounding=$solidOrSolexa.xSinglePaired.xpParams.xpRounding - --maqSoapAlign=$solidOrSolexa.xSinglePaired.xpParams.xpMaqSoapAlign - --minInsert=$solidOrSolexa.xSinglePaired.xpParams.xpMinInsert - --maxInsert=$solidOrSolexa.xSinglePaired.xpParams.xpMaxInsert - --mateOrient=$solidOrSolexa.xSinglePaired.xpParams.xpMateOrient - --maxAlignAttempt=$solidOrSolexa.xSinglePaired.xpParams.xpMaxAlignAttempt - --forwardAlign=$solidOrSolexa.xSinglePaired.xpParams.xpForwardAlign - --reverseAlign=$solidOrSolexa.xSinglePaired.xpParams.xpReverseAlign - --tryHard=$solidOrSolexa.xSinglePaired.xpParams.xpTryHard - --valAlign=$solidOrSolexa.xSinglePaired.xpParams.xpValAlign - --allValAligns=$solidOrSolexa.xSinglePaired.xpParams.xpAllValAligns - --suppressAlign=$solidOrSolexa.xSinglePaired.xpParams.xpSuppressAlign - --best=$solidOrSolexa.xSinglePaired.xpParams.xpBestOption.xpBest - #if $solidOrSolexa.xSinglePaired.xpParams.xpBestOption.xpBest == "xpDoBest": - --maxBacktracks=$solidOrSolexa.xSinglePaired.xpParams.xpBestOption.xpdMaxBacktracks - --strata=$solidOrSolexa.xSinglePaired.xpParams.xpBestOption.xpdStrata - #else: - --maxBacktracks=$solidOrSolexa.xSinglePaired.xpParams.xpBestOption.xpnMaxBacktracks - --strata="None" - #end if - --offrate=$solidOrSolexa.xSinglePaired.xpParams.xpOffrate - --seed=$solidOrSolexa.xSinglePaired.xpParams.xpSeed - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --minInsert="None" - --maxInsert="None" - --mateOrient="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" - #end if - --snpphred="None" - --snpfrac="None" - --keepends="None" - #end if -#end if + bowtie_wrapper.py + --threads="4" + --dataType="solexa" + --output=$output + --suppressHeader=$suppressHeader + --genomeSource=$refGenomeSource.genomeSource + --snpphred="None" + --snpfrac="None" + --keepends="None" + #if $refGenomeSource.genomeSource == "history": + --ref=$refGenomeSource.ownFile + --dbkey=$dbkey + --indexSettings=$refGenomeSource.indexParams.indexSettings + #if $refGenomeSource.indexParams.indexSettings == "indexFull": + --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB + #if $refGenomeSource.indexParams.autoBehavior.autoB == "set": + --ipacked=$refGenomeSource.indexParams.autoBehavior.packed + --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax + --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn + --idcv=$refGenomeSource.indexParams.autoBehavior.dcv + #else: + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + #end if + --inodc=$refGenomeSource.indexParams.nodc + --inoref=$refGenomeSource.indexParams.noref + --ioffrate=$refGenomeSource.indexParams.offrate + --iftab=$refGenomeSource.indexParams.ftab + --intoa=$refGenomeSource.indexParams.ntoa + --iendian=$refGenomeSource.indexParams.endian + --iseed=$refGenomeSource.indexParams.seed + --icutoff=$refGenomeSource.indexParams.cutoff + #else: + --iautoB="None" + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + --inodc="None" + --inoref="None" + --ioffrate="None" + --iftab="None" + --intoa="None" + --iendian="None" + --iseed="None" + --icutoff="None" + #end if + #else: + --ref=$refGenomeSource.index.value + --dbkey="None" + --indexSettings="None" + --iautoB="None" + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + --inodc="None" + --inoref="None" + --ioffrate="None" + --iftab="None" + --intoa="None" + --iendian="None" + --iseed="None" + --icutoff="None" + #end if + --paired=$singlePaired.sPaired + #if $singlePaired.sPaired == "single": + --input1=$singlePaired.sInput1 + --input2="None" + --params=$singlePaired.sParams.sSettingsType + #if $singlePaired.sParams.sSettingsType == "full": + --skip=$singlePaired.sParams.sSkip + --alignLimit=$singlePaired.sParams.sAlignLimit + --trimH=$singlePaired.sParams.sTrimH + --trimL=$singlePaired.sParams.sTrimL + --mismatchSeed=$singlePaired.sParams.sMismatchSeed + --mismatchQual=$singlePaired.sParams.sMismatchQual + --seedLen=$singlePaired.sParams.sSeedLen + --rounding=$singlePaired.sParams.sRounding + --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign + --tryHard=$singlePaired.sParams.sTryHard + --valAlign=$singlePaired.sParams.sValAlign + --allValAligns=$singlePaired.sParams.sAllValAligns + --suppressAlign=$singlePaired.sParams.sSuppressAlign + --best=$singlePaired.sParams.sBestOption.sBest + #if $singlePaired.sParams.sBestOption.sBest == "doBest": + --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks + --strata=$singlePaired.sParams.sBestOption.sdStrata + #else: + --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks + --strata="None" + #end if + --offrate=$singlePaired.sParams.sOffrate + --seed=$singlePaired.sParams.sSeed + #else: + --skip="None" + --alignLimit="None" + --trimH="None" + --trimL="None" + --mismatchSeed="None" + --mismatchQual="None" + --seedLen="None" + --rounding="None" + --maqSoapAlign="None" + --tryHard="None" + --valAlign="None" + --allValAligns="None" + --suppressAlign="None" + --best="None" + --maxBacktracks="None" + --strata="None" + --offrate="None" + --seed="None" + --snpphred="None" + --snpfrac="None" + --keepends="None" + #end if + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + #else: + --input1=$singlePaired.pInput1 + --input2=$singlePaired.pInput2 + --params=$singlePaired.pParams.pSettingsType + #if $singlePaired.pParams.pSettingsType == "full": + --skip=$singlePaired.pParams.pSkip + --alignLimit=$singlePaired.pParams.pAlignLimit + --trimH=$singlePaired.pParams.pTrimH + --trimL=$singlePaired.pParams.pTrimL + --mismatchSeed=$singlePaired.pParams.pMismatchSeed + --mismatchQual=$singlePaired.pParams.pMismatchQual + --seedLen=$singlePaired.pParams.pSeedLen + --rounding=$singlePaired.pParams.pRounding + --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign + --minInsert=$singlePaired.pParams.pMinInsert + --maxInsert=$singlePaired.pParams.pMaxInsert + --mateOrient=$singlePaired.pParams.pMateOrient + --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt + --forwardAlign=$singlePaired.pParams.pForwardAlign + --reverseAlign=$singlePaired.pParams.pReverseAlign + --tryHard=$singlePaired.pParams.pTryHard + --valAlign=$singlePaired.pParams.pValAlign + --allValAligns=$singlePaired.pParams.pAllValAligns + --suppressAlign=$singlePaired.pParams.pSuppressAlign + --best=$singlePaired.pParams.pBestOption.pBest + #if $singlePaired.pParams.pBestOption.pBest == "doBest": + --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks + --strata=$singlePaired.pParams.pBestOption.pdStrata + #else: + --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks + --strata="None" + #end if + --offrate=$singlePaired.pParams.pOffrate + --seed=$singlePaired.pParams.pSeed + #else: + --skip="None" + --alignLimit="None" + --trimH="None" + --trimL="None" + --mismatchSeed="None" + --mismatchQual="None" + --seedLen="None" + --rounding="None" + --maqSoapAlign="None" + --tryHard="None" + --valAlign="None" + --allValAligns="None" + --suppressAlign="None" + --best="None" + --maxBacktracks="None" + --strata="None" + --offrate="None" + --seed="None" + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + #end if + #end if </command> <inputs> - <conditional name="solidOrSolexa"> - <param name="dataType" type="select" label="Is your data SOLiD or Solexa?"> - <option value="solid">SOLiD</option> - <option value="solexa">Solexa</option> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> </param> - <when value="solid"> - <conditional name="cRefGenomeSource"> - <param name="cGenomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> - <option value="cIndexed">Use a built-in index</option> - <option value="cHistory">Use one from the history</option> - </param> - <when value="cIndexed"> - <param name="cIndex" type="select" label="Select the reference genome" help="if your genome of interest is not listed - contact Galaxy team"> - <options from_file="bowtie_indices_color.loc"> - <column name="value" index="1" /> - <column name="name" index="0" /> - </options> - </param> - </when> - <when value="cHistory"> - <param name="cOwnFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> - <conditional name="cIndexParams"> - <param name="cIndexSettings" type="select" label="Choose whether to use default options for building indices or to set your own"> - <option value="cIndexPreSet">Default</option> - <option value="cIndexFull">Set your own</option> - </param> - <when value="cIndexPreSet" /> - <when value="cIndexFull"> - <conditional name="cAutoBehavior"> - <param name="cAutoB" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv"> - <option value="cAuto">Automatic behavior</option> - <option value="cSet">Set values (sets --noauto and allows others to be set)</option> - </param> - <when value="cAuto" /> - <when value="cSet"> - <param name="cPacked" type="select" label="Whether or not to use a packed representation for DNA strings (-p)"> - <option value="unpacked">Use regular representation</option> - <option value="packed">Use packed representation</option> - </param> - <param name="cBmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" /> - <param name="cBmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" /> - <param name="cDcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" /> - </when> - </conditional> - <param name="cNodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetitive reference)"> - <option value="dc">Use difference-cover sample</option> - <option value="nodc">Disable difference-cover sample</option> + <when value="indexed"> + <param name="index" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="bowtie_indices.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + </options> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + <conditional name="indexParams"> + <param name="indexSettings" type="select" label="Choose whether to use default options for building indices or to set your own"> + <option value="indexPreSet">Default</option> + <option value="indexFull">Set your own</option> + </param> + <when value="indexPreSet" /> + <when value="indexFull"> + <conditional name="autoBehavior"> + <param name="autoB" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv"> + <option value="auto">Automatic behavior</option> + <option value="set">Set values (sets --noauto and allows others to be set)</option> + </param> + <when value="auto" /> + <when value="set"> + <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)"> + <option value="unpacked">Use regular representation</option> + <option value="packed">Use packed representation</option> </param> - <param name="cNoref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)"> - <option value="ref">Build all index files</option> - <option value="noref">Do not build paired-end alignment index files</option> + <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" /> + <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" /> + <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" /> + </when> + </conditional> + <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetitive reference)"> + <option value="dc">Use difference-cover sample</option> + <option value="nodc">Disable difference-cover sample</option> + </param> + <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)"> + <option value="ref">Build all index files</option> + <option value="noref">Do not build paired-end alignment index files</option> + </param> + <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" /> + <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" /> + <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)"> + <option value="no">Do not convert Ns</option> + <option value="yes">Convert Ns to As</option> + </param> + <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture"> + <option value="little">Little</option> + <option value="big">Big</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> + <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> + </when> <!-- indexFull --> + </conditional> <!-- indexParams --> + </when> <!-- history --> + </conditional> <!-- refGenomeSource --> + <conditional name="singlePaired"> + <param name="sPaired" type="select" label="Is this library mate-paired?"> + <option value="single">Single-end</option> + <option value="paired">Paired-end</option> + </param> + <when value="single"> + <param name="sInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <conditional name="sParams"> + <param name="sSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet" /> + <when value="full"> + <param name="sSkip" type="integer" value="0" label="Skip the first n reads (-s)" /> + <param name="sAlignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" /> + <param name="sTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="sTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="sMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="sMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="sSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="sRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="sMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="sTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="sValAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" /> + <param name="sAllValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="sSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <conditional name="sBestOption"> + <param name="sBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="snMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + </when> + <when value="doBest"> + <param name="sdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="sdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> </param> - <param name="cOffrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" /> - <param name="cFtab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" /> - <param name="cNtoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)"> - <option value="no">Do not convert Ns</option> - <option value="yes">Convert Ns to As</option> + </when> + </conditional> <!-- bestOption --> + <param name="sOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> + <param name="sSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + </when> <!-- full --> + </conditional> <!-- sParams --> + </when> <!-- single --> + <when value="paired"> + <param name="pInput1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="pInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <conditional name="pParams"> + <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet" /> + <when value="full"> + <param name="pSkip" type="integer" value="0" label="Skip the first n pairs (-s)" /> + <param name="pAlignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" /> + <param name="pTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="pTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="pMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="pMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="pSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="pRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="pMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="pMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> + <param name="pMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> + <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> + <option value="fr">FR (for Illumina)</option> + <option value="rf">RF</option> + <option value="ff">FF (for SOLiD)</option> + </param> + <param name="pMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> + <param name="pForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> + <option value="forward">Align against the forward reference strand</option> + <option value="noForward">Do not align against the forward reference strand</option> + </param> + <param name="pReverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)"> + <option value="reverse">Align against the reverse-complement reference strand</option> + <option value="noReverse">Do not align against the reverse-complement reference strand</option> + </param> + <param name="pTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="pValAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" /> + <param name="pAllValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="pSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <conditional name="pBestOption"> + <param name="pBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="pnMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + </when> + <when value="doBest"> + <param name="pdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="pdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> </param> - <param name="cEndian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture"> - <option value="little">Little</option> - <option value="big">Big</option> - </param> - <param name="cSeed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> - <param name="cCutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> - </when> <!-- cIndexFull --> - </conditional> <!-- cIndexParams --> - </when> <!-- cHistory --> - </conditional> <!-- cRefGenomeSource --> - <conditional name="cSinglePaired"> - <param name="cSPaired" type="select" label="Is this library mate-paired?"> - <option value="cSingle">Single-end</option> - <option value="cPaired">Paired-end</option> - </param> - <when value="cSingle"> - <param name="csInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> - <conditional name="csParams"> - <param name="csSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="csPreSet">Commonly used</option> - <option value="csFull">Full parameter list</option> - </param> - <when value="csPreSet" /> - <when value="csFull"> - <param name="csSkip" type="integer" value="0" label="Skip the first n reads (-s)" /> - <param name="csAlignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" /> - <param name="csTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> - <param name="csTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> - <param name="csMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> - <param name="csMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> - <param name="csSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> - <param name="csRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> - <option value="round">Round to nearest 10</option> - <option value="noRound">Do not round to nearest 10</option> - </param> - <param name="csMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> - <param name="csTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> - <option value="noTryHard">Do not try hard</option> - <option value="doTryHard">Try hard</option> - </param> - <param name="csValAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" /> - <param name="csAllValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)"> - <option value="noAllValAligns">Do not report all valid alignments</option> - <option value="doAllValAligns">Report all valid alignments</option> - </param> - <param name="csSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> - <conditional name="csBestOption"> - <param name="csBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> - <option value="csNoBest">Do not use best</option> - <option value="csDoBest">Use best</option> - </param> - <when value="csNoBest"> - <param name="csnMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - </when> - <when value="csDoBest"> - <param name="csdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="csdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> - <option value="noStrata">Do not use strata option</option> - <option value="doStrata">Use strata option</option> - </param> - </when> - </conditional> <!-- csBestOption --> - <param name="csOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> - <param name="csSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> - <param name="csSnpphred" type="integer" value="-1" label="SNP penalty (ratio of SNPs per base in the subject genome) (--snpphred)" help="Enter this OR Ratio of SNPs per base" /> - <param name="csSnpfrac" type="float" value="0.001" label="Ratio of SNPs per base (estimated ratio for colorspace alignments) (--snpfrac)" help="Enter this OR SNP penalty" /> - <param name="csKeepends" type="select" label="Keep the extreme-ends nucleotides and qualities rather than trimming them (--keepends)"> - <option value="doKeepends">Keep ends</option> - <option value="noKeepends">Trim ends</option> - </param> - </when> <!-- csFull --> - </conditional> <!-- csParams --> - </when> <!-- cSingle --> - <when value="cPaired"> - <param name="cpInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> - <param name="cpInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> - <conditional name="cpParams"> - <param name="cpSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="cpPreSet">Commonly used</option> - <option value="cpFull">Full parameter list</option> - </param> - <when value="cpPreSet" /> - <when value="cpFull"> - <param name="cpSkip" type="integer" value="0" label="Skip the first n pairs (-s)" /> - <param name="cpAlignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" /> - <param name="cpTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> - <param name="cpTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> - <param name="cpMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> - <param name="cpMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> - <param name="cpSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> - <param name="cpRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> - <option value="round">Round to nearest 10</option> - <option value="noRound">Do not round to nearest 10</option> - </param> - <param name="cpMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> - <param name="cpMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> - <param name="cpMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> - <param name="cpMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> - <option value="fr">FR (for Illumina)</option> - <option value="rf">RF</option> - <option value="ff">FF</option> - </param> - <param name="cpMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> - <param name="cpForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> - <option value="forward">Align against the forward reference strand</option> - <option value="noForward">Do not align against the forward reference strand</option> - </param> - <param name="cpReverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)"> - <option value="reverse">Align against the reverse-complement reference strand</option> - <option value="noReverse">Do not align against the reverse-complement reference strand</option> - </param> - <param name="cpTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> - <option value="noTryHard">Do not try hard</option> - <option value="doTryHard">Try hard</option> - </param> - <param name="cpValAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" /> - <param name="cpAllValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)"> - <option value="noAllValAligns">Do not report all valid alignments</option> - <option value="doAllValAligns">Report all valid alignments</option> - </param> - <param name="cpSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> - <conditional name="cpBestOption"> - <param name="cpBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> - <option value="cpNoBest">Do not use best</option> - <option value="cpDoBest">Use best</option> - </param> - <when value="cpNoBest"> - <param name="cpnMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - </when> - <when value="cpDoBest"> - <param name="cpdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="cpdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> - <option value="noStrata">Do not use strata option</option> - <option value="doStrata">Use strata option</option> - </param> - </when> - </conditional> <!-- cpBestOption --> - <param name="cpOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> - <param name="cpSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> - <param name="cpSnpphred" type="integer" value="-1" label="SNP penalty (ratio of SNPs per base in the subject genome) (--snpphred)" help="Enter this OR Ratio of SNPs per base" /> - <param name="cpSnpfrac" type="float" value="0.001" label="Ratio of SNPs per base (estimated ratio for colorspace alignments) (--snpfrac)" help="Enter this OR SNP penalty" /> - <param name="cpKeepends" type="select" label="Keep the extreme-ends nucleotides and qualities rather than trimming them (--keepends)"> - <option value="doKeepends">Keep ends</option> - <option value="noKeepends">Trim ends</option> - </param> - </when> <!-- cpFull --> - </conditional> <!-- cpParams --> - </when> <!-- cPaired --> - </conditional> <!-- cSinglePaired --> - </when> <!-- solid --> - <when value="solexa"> - <conditional name="xRefGenomeSource"> - <param name="xGenomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> - <option value="xIndexed">Use a built-in index</option> - <option value="xHistory">Use one from the history</option> - </param> - <when value="xIndexed"> - <param name="xIndex" type="select" label="Select the reference genome" help="if your genome of interest is not listed - contact Galaxy team"> - <options from_file="bowtie_indices.loc"> - <column name="value" index="1" /> - <column name="name" index="0" /> - </options> - </param> - </when> - <when value="xHistory"> - <param name="xOwnFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> - <conditional name="xIndexParams"> - <param name="xIndexSettings" type="select" label="Choose whether to use default options for building indices or to set your own"> - <option value="xIndexPreSet">Default</option> - <option value="xIndexFull">Set your own</option> - </param> - <when value="xIndexPreSet" /> - <when value="xIndexFull"> - <conditional name="xAutoBehavior"> - <param name="xAutoB" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv"> - <option value="xAuto">Automatic behavior</option> - <option value="xSet">Set values (sets --noauto and allows others to be set)</option> - </param> - <when value="xAuto" /> - <when value="xSet"> - <param name="xPacked" type="select" label="Whether or not to use a packed representation for DNA strings (-p)"> - <option value="unpacked">Use regular representation</option> - <option value="packed">Use packed representation</option> - </param> - <param name="xBmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" /> - <param name="xBmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" /> - <param name="xDcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" /> - </when> - </conditional> - <param name="xNodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetitive reference)"> - <option value="dc">Use difference-cover sample</option> - <option value="nodc">Disable difference-cover sample</option> - </param> - <param name="xNoref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)"> - <option value="ref">Build all index files</option> - <option value="noref">Do not build paired-end alignment index files</option> - </param> - <param name="xOffrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" /> - <param name="xFtab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" /> - <param name="xNtoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)"> - <option value="no">Do not convert Ns</option> - <option value="yes">Convert Ns to As</option> - </param> - <param name="xEndian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture"> - <option value="little">Little</option> - <option value="big">Big</option> - </param> - <param name="xSeed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> - <param name="xCutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> - </when> <!-- xIndexFull --> - </conditional> <!-- xIndexParams --> - </when> <!-- xHistory --> - </conditional> <!-- xRefGenomeSource --> - <conditional name="xSinglePaired"> - <param name="xSPaired" type="select" label="Is this library mate-paired?"> - <option value="xSingle">Single-end</option> - <option value="xPaired">Paired-end</option> - </param> - <when value="xSingle"> - <param name="xsInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> - <conditional name="xsParams"> - <param name="xsSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="xsPreSet">Commonly used</option> - <option value="xsFull">Full parameter list</option> - </param> - <when value="xsPreSet" /> - <when value="xsFull"> - <param name="xsSkip" type="integer" value="0" label="Skip the first n reads (-s)" /> - <param name="xsAlignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" /> - <param name="xsTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> - <param name="xsTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> - <param name="xsMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> - <param name="xsMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> - <param name="xsSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> - <param name="xsRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> - <option value="round">Round to nearest 10</option> - <option value="noRound">Do not round to nearest 10</option> - </param> - <param name="xsMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> - <param name="xsTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> - <option value="noTryHard">Do not try hard</option> - <option value="doTryHard">Try hard</option> - </param> - <param name="xsValAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" /> - <param name="xsAllValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)"> - <option value="noAllValAligns">Do not report all valid alignments</option> - <option value="doAllValAligns">Report all valid alignments</option> - </param> - <param name="xsSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> - <conditional name="xsBestOption"> - <param name="xsBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> - <option value="xsNoBest">Do not use best</option> - <option value="xsDoBest">Use best</option> - </param> - <when value="xsNoBest"> - <param name="xsnMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - </when> - <when value="xsDoBest"> - <param name="xsdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="xsdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> - <option value="noStrata">Do not use strata option</option> - <option value="doStrata">Use strata option</option> - </param> - </when> - </conditional> <!-- xsBestOption --> - <param name="xsOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> - <param name="xsSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> - </when> <!-- xsFull --> - </conditional> <!-- xsParams --> - </when> <!-- xSingle --> - <when value="xPaired"> - <param name="xpInput1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> - <param name="xpInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> - <conditional name="xpParams"> - <param name="xpSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> - <option value="xpPreSet">Commonly used</option> - <option value="xpFull">Full parameter list</option> - </param> - <when value="xpPreSet" /> - <when value="xpFull"> - <param name="xpSkip" type="integer" value="0" label="Skip the first n pairs (-s)" /> - <param name="xpAlignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" /> - <param name="xpTrimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> - <param name="xpTrimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> - <param name="xpMismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> - <param name="xpMismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> - <param name="xpSeedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> - <param name="xpRounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> - <option value="round">Round to nearest 10</option> - <option value="noRound">Do not round to nearest 10</option> - </param> - <param name="xpMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> - <param name="xpMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> - <param name="xpMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> - <param name="xpMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> - <option value="fr">FR (for Illumina)</option> - <option value="rf">RF</option> - <option value="ff">FF</option> - </param> - <param name="xpMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> - <param name="xpForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> - <option value="forward">Align against the forward reference strand</option> - <option value="noForward">Do not align against the forward reference strand</option> - </param> - <param name="xpReverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)"> - <option value="reverse">Align against the reverse-complement reference strand</option> - <option value="noReverse">Do not align against the reverse-complement reference strand</option> - </param> - <param name="xpTryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> - <option value="noTryHard">Do not try hard</option> - <option value="doTryHard">Try hard</option> - </param> - <param name="xpValAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" /> - <param name="xpAllValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)"> - <option value="noAllValAligns">Do not report all valid alignments</option> - <option value="doAllValAligns">Report all valid alignments</option> - </param> - <param name="xpSuppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> - <conditional name="xpBestOption"> - <param name="xpBest" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> - <option value="xpNoBest">Do not use best</option> - <option value="xpDoBest">Use best</option> - </param> - <when value="xpNoBest"> - <param name="xpnMaxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - </when> - <when value="xpDoBest"> - <param name="xpdMaxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="xpdStrata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> - <option value="noStrata">Do not use strata option</option> - <option value="doStrata">Use strata option</option> - </param> - </when> - </conditional> <!-- xpBestOption --> - <param name="xpOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> - <param name="xpSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> - </when> <!-- xpFull --> - </conditional> <!-- xpParams --> - </when> <!-- xPaired --> - </conditional> <!-- xSinglePaired --> - </when> <!-- solexa --> - </conditional> <!-- solidOrSolexa --> + </when> + </conditional> + <param name="pOffrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> + <param name="pSeed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + </when> <!-- full --> + </conditional> <!-- pParams --> + </when> <!-- paired --> + </conditional> <!-- singlePaired --> <param name="suppressHeader" type="boolean" truevalue="true" falsevalue="false" checked="true" label="Suppress the header in the output SAM file" help="Bowtie produces SAM with several lines of header information" /> </inputs> <outputs> @@ -784,225 +387,93 @@ <test> <!-- Bowtie command: - bowtie -p 4 -S +sam-nohead -q -C chrM_color test-data/bowtie_in1.fastqsanger > test-data/bowtie_out1.sam - -p is the number of threads, which is hardcoded above. You need to replace the + with 2 dashes. - chrM_color needs to be the base location/name of the index files. - --> - <param name="dataType" value="solid" /> - <param name="cGenomeSource" value="cIndexed" /> - <param name="cIndex" value="equCab2chrM" /> - <param name="cSPaired" value="cSingle" /> - <param name="csInput1" ftype="fastqsanger" value="bowtie_in1.fastqsanger" /> - <param name="csSettingsType" value="csPreSet" /> - <param name="suppressHeader" value="true" /> - <output name="output" ftype="sam" file="bowtie_out1.sam" /> - </test> - <test> - <!-- - Bowtie command: bowtie -p 4 -S +sam-nohead -q chrM_base test-data/bowtie_in2.fastqsanger > test-data/bowtie_out2.sam -p is the number of threads, which is hardcoded above. You need to replace the + with 2 dashes. chrM_base needs to be the base location/name of the index files. --> - <param name="dataType" value="solexa" /> - <param name="xGenomeSource" value="xIndexed" /> - <param name="xIndex" value="equCab2chrM" /> - <param name="xSPaired" value="xSingle" /> - <param name="xsInput1" ftype="fastqsanger" value="bowtie_in2.fastqsanger" /> - <param name="xsSettingsType" value="xsPreSet" /> + <param name="genomeSource" value="indexed" /> + <param name="index" value="equCab2chrM" /> + <param name="sPaired" value="single" /> + <param name="sInput1" ftype="fastqsanger" value="bowtie_in2.fastqsanger" /> + <param name="sSettingsType" value="preSet" /> <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out2.sam" /> </test> <test> <!-- Bowtie command: - bowtie-build -f -C test-data/chr_m.fasta chrM_color - bowtie -n 2 -e 70 -l 28 -X 250 +fr +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam - -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. - chrM_base is the index files' location/base name. - --> - <param name="dataType" value="solid" /> - <param name="cGenomeSource" value="cHistory" /> - <param name="cOwnFile" value="chr_m.fasta" /> - <param name="cIndexSettings" value="cIndexPreSet" /> - <param name="cSPaired" value="cPaired" /> - <param name="cpInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" /> - <param name="cpInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" /> - <param name="cpSettingsType" value="cpFull" /> - <param name="cpSkip" value="0" /> - <param name="cpAlignLimit" value="-1" /> - <param name="cpTrimH" value="0" /> - <param name="cpTrimL" value="0" /> - <param name="cpMismatchSeed" value="2" /> - <param name="cpMismatchQual" value="70" /> - <param name="cpSeedLen" value="28" /> - <param name="cpRounding" value="round" /> - <param name="cpMaqSoapAlign" value="-1" /> - <param name="cpMinInsert" value="0" /> - <param name="cpMaxInsert" value="250" /> - <param name="cpMateOrient" value="fr" /> - <param name="cpMaxAlignAttempt" value="100" /> - <param name="cpForwardAlign" value="forward" /> - <param name="cpReverseAlign" value="reverse" /> - <param name="cpTryHard" value="noTryHard" /> - <param name="cpValAlign" value="1" /> - <param name="cpAllValAligns" value="noAllValAligns" /> - <param name="cpSuppressAlign" value="-1" /> - <param name="cpBest" value="cpNoBest" /> - <param name="cpnMaxBacktracks" value="125" /> - <param name="cpOffrate" value="-1" /> - <param name="cpSeed" value="-1" /> - <param name="cpSnpphred" value="-1" /> - <param name="cpSnpfrac" value="0.001" /> - <param name="cpKeepends" value="doKeepends" /> - <param name="suppressHeader" value="true" /> - <output name="output" ftype="sam" file="bowtie_out3.sam" /> - </test> - <test> - <!-- - Bowtie command: bowtie-build -f test-data/chr_m.fasta chrM_base bowtie -n 2 -e 70 -l 28 -X 250 +fr +pairtries 100 +maxbts 800 -k 1 +best -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out4.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> - <param name="dataType" value="solexa" /> - <param name="xGenomeSource" value="xHistory" /> - <param name="xOwnFile" value="chr_m.fasta" /> - <param name="xIndexSettings" value="xIndexPreSet" /> - <param name="xSPaired" value="xPaired" /> - <param name="xpInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" /> - <param name="xpInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" /> - <param name="xpSettingsType" value="xpFull" /> - <param name="xpSkip" value="0" /> - <param name="xpAlignLimit" value="-1" /> - <param name="xpTrimH" value="0" /> - <param name="xpTrimL" value="0" /> - <param name="xpMismatchSeed" value="2" /> - <param name="xpMismatchQual" value="70" /> - <param name="xpSeedLen" value="28" /> - <param name="xpRounding" value="round" /> - <param name="xpMaqSoapAlign" value="-1" /> - <param name="xpMinInsert" value="0" /> - <param name="xpMaxInsert" value="250" /> - <param name="xpMateOrient" value="fr" /> - <param name="xpMaxAlignAttempt" value="100" /> - <param name="xpForwardAlign" value="forward" /> - <param name="xpReverseAlign" value="reverse" /> - <param name="xpTryHard" value="noTryHard" /> - <param name="xpValAlign" value="1" /> - <param name="xpAllValAligns" value="noAllValAligns" /> - <param name="xpSuppressAlign" value="-1" /> - <param name="xpBest" value="xpDoBest" /> - <param name="xpdMaxBacktracks" value="800" /> - <param name="xpdStrata" value="noStrata" /> - <param name="xpOffrate" value="-1" /> - <param name="xpSeed" value="-1" /> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chr_m.fasta" /> + <param name="indexSettings" value="indexPreSet" /> + <param name="sPaired" value="paired" /> + <param name="pInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" /> + <param name="pInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" /> + <param name="pSettingsType" value="full" /> + <param name="pSkip" value="0" /> + <param name="pAlignLimit" value="-1" /> + <param name="pTrimH" value="0" /> + <param name="pTrimL" value="0" /> + <param name="pMismatchSeed" value="2" /> + <param name="pMismatchQual" value="70" /> + <param name="pSeedLen" value="28" /> + <param name="pRounding" value="round" /> + <param name="pMaqSoapAlign" value="-1" /> + <param name="pMinInsert" value="0" /> + <param name="pMaxInsert" value="250" /> + <param name="pMateOrient" value="fr" /> + <param name="pMaxAlignAttempt" value="100" /> + <param name="pForwardAlign" value="forward" /> + <param name="pReverseAlign" value="reverse" /> + <param name="pTryHard" value="noTryHard" /> + <param name="pValAlign" value="1" /> + <param name="pAllValAligns" value="noAllValAligns" /> + <param name="pSuppressAlign" value="-1" /> + <param name="pBest" value="doBest" /> + <param name="pdMaxBacktracks" value="800" /> + <param name="pdStrata" value="noStrata" /> + <param name="pOffrate" value="-1" /> + <param name="pSeed" value="-1" /> <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out4.sam" /> </test> -<!-- Comment out tests 5 and 6 because they are failing for an unknown reason +<!-- Comment out test 3 because they are failing for an unknown reason --> <test> ---> <!-- - Bowtie command: - bowtie -n 2 -e 70 -l 28 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color test-data/bowtie_in1.fastqsanger > test-data/bowtie_out5.sam - -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. - chrM_base is the index files' location/base name. - --> -<!-- <param name="dataType" value="solid" /> - <param name="cGenomeSource" value="cIndexed" /> - <param name="cIndex" value="equCab2chrM" /> - <param name="cSPaired" value="cSingle" /> - <param name="csInput1" value="bowtie_in1.fastqsanger" /> - <param name="csSettingsType" value="csFull" /> - <param name="csSkip" value="0" /> - <param name="csAlignLimit" value="-1" /> - <param name="csTrimH" value="0" /> - <param name="csTrimL" value="0" /> - <param name="csMismatchSeed" value="2" /> - <param name="csMismatchQual" value="70" /> - <param name="csSeedLen" value="28" /> - <param name="csRounding" value="round" /> - <param name="csMaqSoapAlign" value="-1" /> - <param name="csTryHard" value="noTryHard" /> - <param name="csValAlign" value="1" /> - <param name="csAllValAligns" value="noAllValAligns" /> - <param name="csSuppressAlign" value="-1" /> - <param name="csBest" value="csNoBest" /> - <param name="csnMaxBacktracks" value="125" /> - <param name="csOffrate" value="-1" /> - <param name="csSeed" value="-1" /> - <param name="csSnpphred" value="-1" /> - <param name="csSnpfrac" value="0.001" /> - <param name="csKeepends" value="doKeepends" /> - <param name="suppressHeader" value="true" /> - <output name="output" ftype="sam" file="bowtie_out5.sam" /> - </test> - <test> ---> <!-- + <!-- Bowtie command: bowtie -n 2 -e 70 -l 28 -k 1 +maxbts 125 -y -p 4 -S +sam-nohead -q chrM_base test-data/bowtie_in2.fastqsanger > test-data/bowtie_out6.sam -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> -<!-- <param name="dataType" value="solexa" /> - <param name="xGenomeSource" value="xIndexed" /> - <param name="xIndex" value="equCab2chrM" /> - <param name="xSPaired" value="xSingle" /> - <param name="xsInput1" value="bowtie_in2.fastqsanger" /> - <param name="xsSettingsType" value="xsFull" /> - <param name="xsSkip" value="0" /> - <param name="xsAlignLimit" value="-1" /> - <param name="xsTrimH" value="0" /> - <param name="xsTrimL" value="0" /> - <param name="xsMismatchSeed" value="2" /> - <param name="xsMismatchQual" value="70" /> - <param name="xsSeedLen" value="28" /> - <param name="xsRounding" value="round" /> - <param name="xsMaqSoapAlign" value="-1" /> - <param name="xsTryHard" value="doTryHard" /> - <param name="xsValAlign" value="1" /> - <param name="xsAllValAligns" value="noAllValAligns" /> - <param name="xsSuppressAlign" value="-1" /> - <param name="xsBest" value="xsNoBest" /> - <param name="xsnMaxBacktracks" value="125" /> - <param name="xsOffrate" value="-1" /> - <param name="xsSeed" value="-1" /> + <param name="genomeSource" value="indexed" /> + <param name="index" value="equCab2chrM" /> + <param name="sPaired" value="single" /> + <param name="sInput1" ftype="fastqsanger" value="bowtie_in2.fastqsanger" /> + <param name="sSettingsType" value="full" /> + <param name="sSkip" value="0" /> + <param name="sAlignLimit" value="-1" /> + <param name="sTrimH" value="0" /> + <param name="sTrimL" value="0" /> + <param name="sMismatchSeed" value="2" /> + <param name="sMismatchQual" value="70" /> + <param name="sSeedLen" value="28" /> + <param name="sRounding" value="round" /> + <param name="sMaqSoapAlign" value="-1" /> + <param name="sTryHard" value="doTryHard" /> + <param name="sValAlign" value="1" /> + <param name="sAllValAligns" value="noAllValAligns" /> + <param name="sSuppressAlign" value="-1" /> + <param name="sBest" value="noBest" /> + <param name="snMaxBacktracks" value="125" /> + <param name="sOffrate" value="-1" /> + <param name="sSeed" value="-1" /> <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out6.sam" /> </test> ---> <test> - <!-- - Bowtie command: - bowtie-build +noauto +bmaxdivn 4 +dcv 1024 +offrate 5 +ftabchars 10 +little -C -f test-data/chr_m.fasta chrM_color - bowtie -p 4 -S +sam-nohead -q -C chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out7.sam - -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. - chrM_base is the index files' location/base name. - --> - <param name="dataType" value="solid" /> - <param name="cGenomeSource" value="cHistory" /> - <param name="cOwnFile" value="chr_m.fasta" /> - <param name="cIndexSettings" value="cIndexFull" /> - <param name="cAutoB" value="cSet" /> - <param name="cPacked" value="unpacked" /> - <param name="cBmax" value="-1" /> - <param name="cBmaxdivn" value="4" /> - <param name="cDcv" value="1024" /> - <param name="cNodc" value="dc" /> - <param name="cNoref" value="ref" /> - <param name="cOffrate" value="5" /> - <param name="cFtab" value="10" /> - <param name="cNtoa" value="no" /> - <param name="cEndian" value="little" /> - <param name="cSeed" value="-1" /> - <param name="cCutoff" value="-1" /> - <param name="cSPaired" value="cPaired" /> - <param name="cpInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" /> - <param name="cpInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" /> - <param name="cpSettingsType" value="cpPreSet" /> - <param name="suppressHeader" value="true" /> - <output name="output" ftype="sam" file="bowtie_out7.sam" /> - </test> <test> <!-- Bowtie command: @@ -1011,23 +482,22 @@ -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes. chrM_base is the index files' location/base name. --> - <param name="dataType" value="solexa" /> - <param name="xGenomeSource" value="xHistory" /> - <param name="xOwnFile" value="chr_m.fasta" /> - <param name="xIndexSettings" value="xIndexFull" /> - <param name="xAutoB" value="xAuto" /> - <param name="xNodc" value="dc" /> - <param name="xNoref" value="ref" /> - <param name="xOffrate" value="5" /> - <param name="xFtab" value="10" /> - <param name="xNtoa" value="no" /> - <param name="xEndian" value="little" /> - <param name="xSeed" value="-1" /> - <param name="xCutoff" value="-1" /> - <param name="xSPaired" value="xPaired" /> - <param name="xpInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" /> - <param name="xpInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" /> - <param name="xpSettingsType" value="xpPreSet" /> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chr_m.fasta" /> + <param name="indexSettings" value="indexFull" /> + <param name="autoB" value="auto" /> + <param name="nodc" value="dc" /> + <param name="noref" value="ref" /> + <param name="offrate" value="5" /> + <param name="ftab" value="10" /> + <param name="ntoa" value="no" /> + <param name="endian" value="little" /> + <param name="seed" value="-1" /> + <param name="cutoff" value="-1" /> + <param name="sPaired" value="paired" /> + <param name="pInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" /> + <param name="pInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" /> + <param name="pSettingsType" value="preSet" /> <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out8.sam" /> </test> diff -r b78de785df21 -r 35d2a31cfbaf tools/sr_mapping/bowtie_wrapper_code.py --- a/tools/sr_mapping/bowtie_wrapper_code.py Tue Jan 12 15:48:21 2010 -0500 +++ b/tools/sr_mapping/bowtie_wrapper_code.py Tue Jan 12 16:49:02 2010 -0500 @@ -2,19 +2,12 @@
def exec_before_job(app, inp_data, out_data, param_dict, tool): try: - try: - refFile = param_dict[ 'solidOrSolexa' ][ 'cRefGenomeSource' ][ 'cIndex' ].value - except: - refFile = param_dict[ 'solidOrSolexa' ][ 'xRefGenomeSource' ][ 'xIndex' ].value + refFile = param_dict[ 'refGenomeSource' ][ 'index' ].value except: try: - try: - refFile = param_dict[ 'solidOrSolexa' ][ 'cRefGenomeSource' ][ 'cOwnFile' ].dbkey - except: - refFile = param_dict[ 'solidOrSolexa' ][ 'xRefGenomeSource' ][ 'xOwnFile' ].dbkey + refFile = param_dict[ 'refGenomeSource' ][ 'ownFile' ].dbkey except: - out_data[ 'output' ].set_dbkey( '?' ) - return + refFile = '?' dbkey = os.path.split( refFile )[1].split( '.' )[0] # deal with the one odd case if dbkey.find( 'chrM' ) >= 0 or dbkey.find( 'chr_m' ) >= 0: