details: http://www.bx.psu.edu/hg/galaxy/rev/e9104d403af7 changeset: 2745:e9104d403af7 user: Anton Nekrutenko anton@bx.psu.edu date: Tue Sep 22 08:59:36 2009 -0400 description: Second pass of help and interface updates. Not done yet...
19 file(s) affected in this change:
static/images/solid_qual.png tool_conf.xml.sample tools/fastx_toolkit/fastq_quality_boxplot.xml tools/fastx_toolkit/fastq_quality_converter.xml tools/fastx_toolkit/fastq_quality_filter.xml tools/fastx_toolkit/fastq_to_fasta.xml tools/fastx_toolkit/fastx_artifacts_filter.xml tools/fastx_toolkit/fastx_nucleotides_distribution.xml tools/fastx_toolkit/fastx_quality_statistics.xml tools/fastx_toolkit/fastx_renamer.xml tools/fastx_toolkit/fastx_reverse_complement.xml tools/fastx_toolkit/fastx_trimmer.xml tools/metag_tools/short_reads_figure_score.xml tools/metag_tools/short_reads_trim_seq.xml tools/metag_tools/split_paired_reads.xml tools/solid_tools/solid_qual_boxplot.xml tools/solid_tools/solid_qual_stats.xml tools/sr_mapping/bowtie_wrapper.xml tools/sr_mapping/bwa_wrapper.xml
diffs (499 lines):
diff -r 97381671a8e7 -r e9104d403af7 static/images/solid_qual.png Binary file static/images/solid_qual.png has changed diff -r 97381671a8e7 -r e9104d403af7 tool_conf.xml.sample --- a/tool_conf.xml.sample Mon Sep 21 20:13:20 2009 -0400 +++ b/tool_conf.xml.sample Tue Sep 22 08:59:36 2009 -0400 @@ -70,8 +70,10 @@ <tool file="maf/maf_to_interval.xml" /> <tool file="maf/maf_to_fasta.xml" /> <tool file="fasta_tools/tabular_to_fasta.xml" /> + <tool file="fastx_toolkit/fastq_to_fasta.xml" /> <tool file="next_gen_conversion/solid_to_fastq.xml" /> <tool file="next_gen_conversion/fastq_conversions.xml" /> + <tool file="fastx_toolkit/fastq_quality_converter.xml" /> </section> <section name="Extract Features" id="features"> <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" /> @@ -175,8 +177,6 @@ <tool file="fastx_toolkit/fastq_quality_boxplot.xml" /> <tool file="fastx_toolkit/fastx_nucleotides_distribution.xml" /> <!-- <tool file="fastx_toolkit/fasta_clipping_histogram.xml" /> --> - <tool file="fastx_toolkit/fastq_to_fasta.xml" /> - <tool file="fastx_toolkit/fastq_quality_converter.xml" /> <!-- <tool file="fastx_toolkit/fastx_clipper.xml" /> --> <tool file="fastx_toolkit/fastx_trimmer.xml" /> <tool file="fastx_toolkit/fastx_renamer.xml" /> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastq_quality_boxplot.xml --- a/tools/fastx_toolkit/fastq_quality_boxplot.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastq_quality_boxplot.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,10 +1,10 @@ -<tool id="cshl_fastq_quality_boxplot" name="Quality Score"> - <description>chart</description> +<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot"> + <description></description> <command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command> <inputs> - <param format="txt" name="input" type="data" label="Statistics report file (output of 'FASTQ Statistics' tool)" /> + <param format="txt" name="input" type="data" label="Statistics report file" help="output of 'FASTQ Statistics' tool" /> </inputs>
<outputs> @@ -42,6 +42,14 @@
.. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png
+------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + + + </help> </tool> <!-- FASTQ-Quality-Boxplot is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastq_quality_converter.xml --- a/tools/fastx_toolkit/fastq_quality_converter.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastq_quality_converter.xml Tue Sep 22 08:59:36 2009 -0400 @@ -85,7 +85,12 @@ +CSHL__2_FC042AGWWWXX:8:1:103:1185 hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B
+------
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help> </tool> <!-- FASTQ-Quality-Converter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastq_quality_filter.xml --- a/tools/fastx_toolkit/fastq_quality_filter.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastq_quality_filter.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="cshl_fastq_quality_filter" name="Quality Filter"> +<tool id="cshl_fastq_quality_filter" name="Filter by quality"> <description></description>
<command>zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output</command> @@ -67,7 +67,11 @@
Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
- +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTQ-Quality-Filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastq_to_fasta.xml --- a/tools/fastx_toolkit/fastq_to_fasta.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastq_to_fasta.xml Tue Sep 22 08:59:36 2009 -0400 @@ -65,6 +65,11 @@ >1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastx_artifacts_filter.xml --- a/tools/fastx_toolkit/fastx_artifacts_filter.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastx_artifacts_filter.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,9 +1,9 @@ -<tool id="cshl_fastx_artifacts_filter" name="Artifacts Filter"> +<tool id="cshl_fastx_artifacts_filter" name="Remove sequencing artifacts"> <description></description> <command>zcat -f '$input' | fastx_artifacts_filter -v -o "$output"</command>
<inputs> - <param format="fasta,fastqsolexa" name="input" type="data" label="Library to filter" /> + <param format="fasta,fastqsanger" name="input" type="data" label="Library to filter" />
</inputs>
@@ -74,7 +74,12 @@ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA + +------
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTX-Artifacts-filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastx_nucleotides_distribution.xml --- a/tools/fastx_toolkit/fastx_nucleotides_distribution.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastx_nucleotides_distribution.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,9 +1,9 @@ -<tool id="cshl_fastx_nucleotides_distribution" name="Nucleotides Distribution"> - <description>chart</description> +<tool id="cshl_fastx_nucleotides_distribution" name="Draw nucleotides distribution chart"> + <description></description> <command>fastx_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output</command> <inputs> - <param format="txt" name="input" type="data" label="Statistics Text File (output of 'FASTX Statistics' tool)" /> + <param format="txt" name="input" type="data" label="Statistics Text File" help="output of 'FASTX Statistics' tool" /> </inputs> <outputs> @@ -23,44 +23,28 @@
**Output Examples**
- - The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT**
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_1.png
- - - - - - In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...**
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_2.png - - - - - - -
The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem):
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_3.png
- - - - - - - But most of the time, the chart will look rather random:
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_4.png
+------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help> </tool> <!-- FASTQ-Nucleotides-Distribution is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastx_quality_statistics.xml --- a/tools/fastx_toolkit/fastx_quality_statistics.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastx_quality_statistics.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="cshl_fastx_quality_statistics" name="Quality Statistics"> +<tool id="cshl_fastx_quality_statistics" name="Compute quality statistics"> <description></description> <command>zcat -f $input | fastx_quality_stats -o $output -Q $offset</command>
@@ -55,51 +55,20 @@ * N_Count = Count of 'N' nucleotides found in this column.
+For example::
+ 1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0 + 2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0 + 3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0 + 4 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0 + 36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245 + +------
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
- -**Output Example**:: - - column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count - 1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0 - 2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0 - 3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0 - 4 6362991 -5 40 247654797 38.92 40 40 40 0 40 40 1683197 1410855 1722633 1546306 0 - 5 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0 - 6 6362991 -5 40 248499903 39.05 40 40 40 0 40 40 1598956 1236081 1568608 1959346 0 - 7 6362991 -4 40 247719760 38.93 40 40 40 0 40 40 1692667 1822140 1496741 1351443 0 - 8 6362991 -5 40 245745205 38.62 40 40 40 0 40 40 2230936 1343260 1529928 1258867 0 - 9 6362991 -5 40 245766735 38.62 40 40 40 0 40 40 1702064 1306257 1336511 2018159 0 - 10 6362991 -5 40 245089706 38.52 40 40 40 0 40 40 1519917 1446370 1450995 1945709 0 - 11 6362991 -5 40 242641359 38.13 40 40 40 0 40 40 1717434 1282975 1387804 1974778 0 - 12 6362991 -5 40 242026113 38.04 40 40 40 0 40 40 1662872 1202041 1519721 1978357 0 - 13 6362991 -5 40 238704245 37.51 40 40 40 0 40 40 1549965 1271411 1973291 1566681 1643 - 14 6362991 -5 40 235622401 37.03 40 40 40 0 40 40 2101301 1141451 1603990 1515774 475 - 15 6362991 -5 40 230766669 36.27 40 40 40 0 40 40 2344003 1058571 1440466 1519865 86 - 16 6362991 -5 40 224466237 35.28 38 40 40 2 35 40 2203515 1026017 1474060 1651582 7817 - 17 6362991 -5 40 219990002 34.57 34 40 40 6 25 40 1522515 1125455 2159183 1555765 73 - 18 6362991 -5 40 214104778 33.65 30 40 40 10 15 40 1479795 2068113 1558400 1249337 7346 - 19 6362991 -5 40 212934712 33.46 30 40 40 10 15 40 1432749 1231352 1769799 1920093 8998 - 20 6362991 -5 40 212787944 33.44 29 40 40 11 13 40 1311657 1411663 2126316 1513282 73 - 21 6362991 -5 40 211369187 33.22 28 40 40 12 10 40 1887985 1846300 1300326 1318380 10000 - 22 6362991 -5 40 213371720 33.53 30 40 40 10 15 40 542299 3446249 516615 1848190 9638 - 23 6362991 -5 40 221975899 34.89 36 40 40 4 30 40 347679 1233267 926621 3855355 69 - 24 6362991 -5 40 194378421 30.55 21 40 40 19 -5 40 433560 674358 3262764 1992242 67 - 25 6362991 -5 40 199773985 31.40 23 40 40 17 -2 40 944760 325595 1322800 3769641 195 - 26 6362991 -5 40 179404759 28.20 17 34 40 23 -5 40 3457922 156013 1494664 1254293 99 - 27 6362991 -5 40 163386668 25.68 13 28 40 27 -5 40 1392177 281250 3867895 821491 178 - 28 6362991 -5 40 156230534 24.55 12 25 40 28 -5 40 907189 981249 4174945 299437 171 - 29 6362991 -5 40 163236046 25.65 13 28 40 27 -5 40 1097171 3418678 1567013 280008 121 - 30 6362991 -5 40 151309826 23.78 12 23 40 28 -5 40 3514775 2036194 566277 245613 132 - 31 6362991 -5 40 141392520 22.22 10 21 40 30 -5 40 1569000 4571357 124732 97721 181 - 32 6362991 -5 40 143436943 22.54 10 21 40 30 -5 40 1453607 4519441 38176 351107 660 - 33 6362991 -5 40 114269843 17.96 6 14 30 24 -5 40 3311001 2161254 155505 734297 934 - 34 6362991 -5 40 140638447 22.10 10 20 40 30 -5 40 1501615 1637357 18113 3205237 669 - 35 6362991 -5 40 138910532 21.83 10 20 40 30 -5 40 1532519 3495057 23229 1311834 352 - 36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245 - + .. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help> -</tool> + </tool> <!-- FASTQ-Statistics is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastx_renamer.xml --- a/tools/fastx_toolkit/fastx_renamer.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastx_renamer.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ -<tool id="cshl_fastx_renamer" name="Rename" version="0.0.11" > - <description>sequence identifiers</description> +<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" > + <description></description> <command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v </command>
<inputs> @@ -50,7 +50,11 @@ +1 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
- +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastx_reverse_complement.xml --- a/tools/fastx_toolkit/fastx_reverse_complement.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastx_reverse_complement.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ <tool id="cshl_fastx_reverse_complement" name="Reverse-Complement"> - <description>sequences</description> + <description></description> <command>zcat -f '$input' | fastx_reverse_complement -v -o $output</command> <inputs> <param format="fasta,fastqsolexa" name="input" type="data" label="Library to reverse-complement" /> @@ -47,6 +47,11 @@ TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA +CSHL_1_FC42AGWWWXX:8:1:3:740 26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33 +------
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help> </tool> diff -r 97381671a8e7 -r e9104d403af7 tools/fastx_toolkit/fastx_trimmer.xml --- a/tools/fastx_toolkit/fastx_trimmer.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/fastx_toolkit/fastx_trimmer.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,9 +1,9 @@ -<tool id="cshl_fastx_trimmer" name="Trim"> - <description>sequences</description> +<tool id="cshl_fastx_trimmer" name="Trim sequences"> + <description></description> <command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output</command>
<inputs> - <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" /> + <param format="fasta,fastasanger" name="input" type="data" label="Library to clip" />
<param name="first" size="4" type="integer" value="1"> <label>First base to keep</label> @@ -65,6 +65,12 @@ >2-1 AGGCT
+ ------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help> </tool> <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> diff -r 97381671a8e7 -r e9104d403af7 tools/metag_tools/short_reads_figure_score.xml --- a/tools/metag_tools/short_reads_figure_score.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/metag_tools/short_reads_figure_score.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ -<tool id="quality_score_distribution" name="Build distribution of base quality"> -<description>values</description> +<tool id="quality_score_distribution" name="Build base quality distribution"> +<description></description>
<command interpreter="python">short_reads_figure_score.py $input1 $output1 </command>
diff -r 97381671a8e7 -r e9104d403af7 tools/metag_tools/short_reads_trim_seq.xml --- a/tools/metag_tools/short_reads_trim_seq.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/metag_tools/short_reads_trim_seq.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ <tool id="trim_reads" name="Select high quality segments" version="1.0.0"> -<description>from short reads</description> +<description></description>
<command interpreter="python"> short_reads_trim_seq.py $trim $length $output1 $input1 $input2 $sequencing_method_choice.input3 diff -r 97381671a8e7 -r e9104d403af7 tools/metag_tools/split_paired_reads.xml --- a/tools/metag_tools/split_paired_reads.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/metag_tools/split_paired_reads.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ -<tool id="split_paired_reads" name="Split" version="1.0.0"> - <description>paired-end reads into two ends</description> +<tool id="split_paired_reads" name="Split paired end reads" version="1.0.0"> + <description></description> <command interpreter="python"> split_paired_reads.py $input $output1 $output2 </command> diff -r 97381671a8e7 -r e9104d403af7 tools/solid_tools/solid_qual_boxplot.xml --- a/tools/solid_tools/solid_qual_boxplot.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/solid_tools/solid_qual_boxplot.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="solid_qual_boxplot" name="Quality Boxplot" version="1.0.0"> +<tool id="solid_qual_boxplot" name="Draw quality score boxplot" version="1.0.0"> <description>for SOLiD data</description> <command interpreter="bash">qualsolid_boxplot_graph.sh -t '$input.name' -i $input -o $output</command> @@ -31,6 +31,10 @@
.. image:: ../static/images/solid_qual.png
+------
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> diff -r 97381671a8e7 -r e9104d403af7 tools/solid_tools/solid_qual_stats.xml --- a/tools/solid_tools/solid_qual_stats.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/solid_tools/solid_qual_stats.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="solid_qual_stats" name="Quality Statistics" version="1.0.0"> +<tool id="solid_qual_stats" name="Compute quality statistics" version="1.0.0"> <description>for SOLiD data</description> <command interpreter="python">solid_qual_stats.py $input $output1</command>
@@ -60,6 +60,10 @@ 34 6362991 2 29 140638447 12.10 3 10 25 22 2 29 35 6362991 2 29 138910532 11.83 3 10 25 22 2 29
+------
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> diff -r 97381671a8e7 -r e9104d403af7 tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ -<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0"> - <description> fast alignment of reads against reference sequence </description> +<tool id="bowtie_wrapper" name="Map with Bowtie" version="1.0.0"> + <description></description> <command interpreter="python"> bowtie_wrapper.py --threads="8" @@ -148,7 +148,7 @@ <option value="history">Use one from the history</option> </param> <when value="indexed"> - <param name="indices" type="select" label="Select a reference genome"> + <param name="indices" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> <options from_file="bowtie_indices.loc"> <column name="value" index="1" /> <column name="name" index="0" /> @@ -215,7 +215,7 @@ <option value="paired">Paired-end</option> </param> <when value="single"> - <param name="input1" type="data" format="fastqsanger" label="FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> <conditional name="params"> <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> <option value="pre_set">Commonly used</option> @@ -272,8 +272,8 @@ </conditional> <!-- params --> </when> <!-- single --> <when value="paired"> - <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" /> - <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> <conditional name="params"> <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> <option value="pre_set">Commonly used</option> diff -r 97381671a8e7 -r e9104d403af7 tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Mon Sep 21 20:13:20 2009 -0400 +++ b/tools/sr_mapping/bwa_wrapper.xml Tue Sep 22 08:59:36 2009 -0400 @@ -1,5 +1,5 @@ -<tool id="bwa_wrapper" name="BWA" version="1.0.1"> - <description> fast mapping of reads against reference sequence</description> +<tool id="bwa_wrapper" name="Map with BWA" version="1.0.1"> + <description></description> <command interpreter="python"> bwa_wrapper.py --threads="8" @@ -76,7 +76,7 @@ <option value="history">Use one from the history</option> </param> <when value="indexed"> - <param name="indices" type="select" label="Select a reference genome"> + <param name="indices" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> <options from_file="sequence_index_color.loc"> <column name="value" index="1" /> <column name="name" index="0" /> @@ -116,11 +116,11 @@ <option value="paired">Paired-end</option> </param> <when value="single"> - <param name="input1" type="data" format="fastqsanger" label="FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> </when> <when value="paired"> - <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" /> - <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/> </when> </conditional> <conditional name="params">