[hg] galaxy 3233: Tweaked the interfaces for Bowtie wrappers for...

22 Jan 2010

details:   http://www.bx.psu.edu/hg/galaxy/rev/ec12f3ad520a
changeset: 3233:ec12f3ad520a
user:      Kelly Vincent <kpvincent@bx.psu.edu>
date:      Wed Jan 13 14:38:40 2010 -0500
description:
Tweaked the interfaces for Bowtie wrappers for paired-end data

diffstat:

 test-data/bowtie_out7.sam                 |   4 +-
 tools/sr_mapping/bowtie_color_wrapper.xml |  32 ++++++++++++++----------------
 tools/sr_mapping/bowtie_wrapper.py        |  21 +++++++++----------
 tools/sr_mapping/bowtie_wrapper.xml       |  31 +++++++++++++----------------
 4 files changed, 41 insertions(+), 47 deletions(-)

diffs (308 lines):

diff -r 4b7a92551151 -r ec12f3ad520a test-data/bowtie_out7.sam

--- a/test-data/bowtie_out7.sam	Wed Jan 13 13:19:25 2010 -0500
+++ b/test-data/bowtie_out7.sam	Wed Jan 13 14:38:40 2010 -0500
@@ -1,2 +1,2 @@
-869_1532_1255	77	*	0	0	*	*	0	0	CAGGGTTCCAAATCGGGTTGCAAG	=;8:?@=?;;9:8;=>;5A?;<8>	XM:i:0
-869_1532_1255	141	*	0	0	*	*	0	0	TACGGGAAACCGCGGCCTTTAAGG	;89<:==5<8>69;8=<9;<>9:=	XM:i:0
+869_1532_1255	179	chrM	3728	255	23M	=	3752	47	GAAATATGTCTGACAAAAGAGTT	!RVYVSTXTRSNSUSPQYVUTPR	XA:i:1	MD:Z:23	NM:i:0	CM:i:1
+869_1532_1255	115	chrM	3753	255	23M	=	3727	-49	TTTGATAGAGTAAAACATAGAGG	USVY_UOXZWRQRSUY[\^XQR!	XA:i:1	MD:Z:23	NM:i:0	CM:i:1
diff -r 4b7a92551151 -r ec12f3ad520a tools/sr_mapping/bowtie_color_wrapper.xml
--- a/tools/sr_mapping/bowtie_color_wrapper.xml	Wed Jan 13 13:19:25 2010 -0500
+++ b/tools/sr_mapping/bowtie_color_wrapper.xml	Wed Jan 13 14:38:40 2010 -0500
@@ -9,7 +9,6 @@
     --genomeSource=$refGenomeSource.genomeSource
     #if $refGenomeSource.genomeSource == "history":
      --ref=$refGenomeSource.ownFile
-     --dbkey=$dbkey
      --indexSettings=$refGenomeSource.indexParams.indexSettings
      #if $refGenomeSource.indexParams.indexSettings == "indexFull":
       --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB
@@ -49,7 +48,6 @@
      #end if
     #else:
      --ref=$refGenomeSource.index.value
-     --dbkey="None"
      --indexSettings="None"
      --iautoB="None"
      --ipacked="None"
@@ -129,6 +127,8 @@
     #else:
      --input1=$singlePaired.pInput1
      --input2=$singlePaired.pInput2
+     --maxInsert=$singlePaired.pMaxInsert
+     --mateOrient=$singlePaired.pMateOrient
      --params=$singlePaired.pParams.pSettingsType
      #if $singlePaired.pParams.pSettingsType == "full":
       --skip=$singlePaired.pParams.pSkip
@@ -141,8 +141,6 @@
       --rounding=$singlePaired.pParams.pRounding
       --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign
       --minInsert=$singlePaired.pParams.pMinInsert
-      --maxInsert=$singlePaired.pParams.pMaxInsert
-      --mateOrient=$singlePaired.pParams.pMateOrient
       --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt
       --forwardAlign=$singlePaired.pParams.pForwardAlign
       --reverseAlign=$singlePaired.pParams.pReverseAlign
@@ -174,8 +172,6 @@
       --rounding="None"
       --maqSoapAlign="None"
       --minInsert="None"
-      --maxInsert="None"
-      --mateOrient="None"
       --maxAlignAttempt="None"
       --forwardAlign="None"
       --reverseAlign="None"
@@ -323,6 +319,12 @@
       <when value="paired">
         <param name="pInput1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
         <param name="pInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
+        <param name="pMaxInsert" type="integer" value="1000" label="Maximum insert size for valid paired-end alignments (-X)" />
+        <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
+          <option value="ff">FF (for SOLiD)</option>
+          <option value="fr">FR (for Illumina)</option>
+          <option value="rf">RF</option>
+        </param>
         <conditional name="pParams">
           <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
 		    <option value="preSet">Commonly used</option>
@@ -343,12 +345,6 @@
             </param>
             <param name="pMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
             <param name="pMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" />
-            <param name="pMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" />
-            <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
-              <option value="ff">FF (for SOLiD)</option>
-              <option value="fr">FR (for Illumina)</option>
-              <option value="rf">RF</option>
-            </param>
             <param name="pMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" />
             <param name="pForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)">
               <option value="forward">Align against the forward reference strand</option>
@@ -421,7 +417,7 @@
       <!--
       Bowtie command:
       bowtie-build -f -C test-data/chr_m.fasta chrM_color
-      bowtie -n 2 -e 70 -l 28 -X 250 +ff +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam
+      bowtie -X 1000 +ff -n 2 -e 70 -l 28 -X 250 +ff +pairtries 100 +maxbts 125 -k 1 -C +snpfrac 0.001 +col-keepends -p 4 -S +sam-nohead -q chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out3.sam
       -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes.
       chrM_base is the index files' location/base name. 
       -->
@@ -431,6 +427,8 @@
       <param name="sPaired" value="paired" />
       <param name="pInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" />
       <param name="pInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" />
+      <param name="pMaxInsert" value="1000" />
+      <param name="pMateOrient" value="ff" />
       <param name="pSettingsType" value="full" />
       <param name="pSkip" value="0" />
       <param name="pAlignLimit" value="-1" />
@@ -442,8 +440,6 @@
       <param name="pRounding" value="round" />
       <param name="pMaqSoapAlign" value="-1" />
       <param name="pMinInsert" value="0" />
-      <param name="pMaxInsert" value="250" />
-      <param name="pMateOrient" value="ff" />
       <param name="pMaxAlignAttempt" value="100" />
       <param name="pForwardAlign" value="forward" />
       <param name="pReverseAlign" value="reverse" />
@@ -500,11 +496,11 @@
       <!--
       Bowtie command:
       bowtie-build +noauto +bmaxdivn 4 +dcv 1024 +offrate 5 +ftabchars 10 +little -C -f test-data/chr_m.fasta chrM_color
-      bowtie -p 4 -S +sam-nohead -q -C chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out7.sam
+      bowtie -X 1000 +ff -p 4 -S +sam-nohead -q -C chrM_color -1 test-data/bowtie_in3.fastqsanger -2 test-data/bowtie_in4.fastqsanger > test-data/bowtie_out7.sam
       -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes.
       chrM_base is the index files' location/base name. 
       -->
-      <param name="genomeSource" value="cHistory" />
+      <param name="genomeSource" value="history" />
       <param name="ownFile" value="chr_m.fasta" />
       <param name="indexSettings" value="indexFull" />
       <param name="autoB" value="set" />
@@ -523,6 +519,8 @@
       <param name="sPaired" value="paired" />
       <param name="pInput1" ftype="fastqsanger" value="bowtie_in3.fastqsanger" />
       <param name="pInput2" ftype="fastqsanger" value="bowtie_in4.fastqsanger" />
+      <param name="pMaxInsert" value="1000" />
+      <param name="pMateOrient" value="ff" />
       <param name="pSettingsType" value="preSet" />
       <param name="suppressHeader" value="true" />
       <output name="output" ftype="sam" file="bowtie_out7.sam" />
diff -r 4b7a92551151 -r ec12f3ad520a tools/sr_mapping/bowtie_wrapper.py
--- a/tools/sr_mapping/bowtie_wrapper.py	Wed Jan 13 13:19:25 2010 -0500
+++ b/tools/sr_mapping/bowtie_wrapper.py	Wed Jan 13 14:38:40 2010 -0500
@@ -40,7 +40,6 @@
     -6, --snpfrac=6: Fraction of sites expected to be SNP sites
     -7, --keepends=7: Keep extreme-end nucleotides and qualities
     -S, --seed=S: Seed for pseudo-random number generator
-    -d, --dbkey=d: Dbkey of reference genome
     -C, --params=C: Whether to use default or specified parameters
     -u, --iautoB=u: Automatic or specified behavior
     -K, --ipacked=K: Whether or not to use a packed representation for DNA strings
@@ -103,7 +102,6 @@
     parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' )
     parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' )
     parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' )
-    parser.add_option( '-d', '--dbkey', dest='dbkey', help='Dbkey of reference genome' )
     parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' )
     parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' )
     parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' )
@@ -206,8 +204,17 @@
         suppressHeader = '--sam-nohead'
     else:
         suppressHeader = ''
+    if options.maxInsert != 'None' and int( options.maxInsert ) > 0:
+        maxInsert = '-X %s' % options.maxInsert
+    else:
+        maxInsert = ''
+    if options.mateOrient != 'None':
+        mateOrient = '--%s' % options.mateOrient
+    else:
+        mateOrient = ''
     if options.params == 'preSet':
-        aligning_cmds = '-p %s -S %s -q %s ' % ( options.threads, suppressHeader, colorspace )
+        aligning_cmds = '%s %s -p %s -S %s -q %s ' % \
+                ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace )
     else:
         try:
             if options.skip != 'None' and int( options.skip ) > 0:
@@ -251,14 +258,6 @@
                 minInsert = '-I %s' % options.minInsert
             else:
                 minInsert = ''
-            if options.maxInsert != 'None' and int( options.maxInsert ) > 0:
-                maxInsert = '-X %s' % options.maxInsert
-            else:
-                maxInsert = ''
-            if options.mateOrient != 'None':
-                mateOrient = '--%s' % options.mateOrient
-            else:
-                mateOrient = ''
             if options.maxAlignAttempt != 'None' and int( options.maxAlignAttempt ) >= 0:
                 maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt
             else:
diff -r 4b7a92551151 -r ec12f3ad520a tools/sr_mapping/bowtie_wrapper.xml
--- a/tools/sr_mapping/bowtie_wrapper.xml	Wed Jan 13 13:19:25 2010 -0500
+++ b/tools/sr_mapping/bowtie_wrapper.xml	Wed Jan 13 14:38:40 2010 -0500
@@ -12,7 +12,6 @@
     --keepends="None"
     #if $refGenomeSource.genomeSource == "history":
      --ref=$refGenomeSource.ownFile
-     --dbkey=$dbkey
      --indexSettings=$refGenomeSource.indexParams.indexSettings
      #if $refGenomeSource.indexParams.indexSettings == "indexFull":
       --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB
@@ -52,7 +51,6 @@
      #end if
     #else:
      --ref=$refGenomeSource.index.value
-     --dbkey="None"
      --indexSettings="None"
      --iautoB="None"
      --ipacked="None"
@@ -129,6 +127,8 @@
     #else:
      --input1=$singlePaired.pInput1
      --input2=$singlePaired.pInput2
+     --maxInsert=$singlePaired.pMaxInsert
+     --mateOrient=$singlePaired.pMateOrient
      --params=$singlePaired.pParams.pSettingsType
      #if $singlePaired.pParams.pSettingsType == "full":
       --skip=$singlePaired.pParams.pSkip
@@ -141,8 +141,6 @@
       --rounding=$singlePaired.pParams.pRounding
       --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign
       --minInsert=$singlePaired.pParams.pMinInsert
-      --maxInsert=$singlePaired.pParams.pMaxInsert
-      --mateOrient=$singlePaired.pParams.pMateOrient
       --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt
       --forwardAlign=$singlePaired.pParams.pForwardAlign
       --reverseAlign=$singlePaired.pParams.pReverseAlign
@@ -180,8 +178,6 @@
       --offrate="None"
       --seed="None"
       --minInsert="None"
-      --maxInsert="None"
-      --mateOrient="None"
       --maxAlignAttempt="None"
       --forwardAlign="None"
       --reverseAlign="None"
@@ -311,6 +307,12 @@
       <when value="paired">
         <param name="pInput1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
         <param name="pInput2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
+        <param name="pMaxInsert" type="integer" value="1000" label="Maximum insert size for valid paired-end alignments (-X)" />
+        <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
+          <option value="fr">FR (for Illumina)</option>
+          <option value="rf">RF</option>
+          <option value="ff">FF (for SOLiD)</option>
+        </param>
         <conditional name="pParams">
           <param name="pSettingsType" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
 		    <option value="preSet">Commonly used</option>
@@ -331,12 +333,6 @@
             </param>
             <param name="pMaqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
             <param name="pMinInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" />
-            <param name="pMaxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" />
-            <param name="pMateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
-              <option value="fr">FR (for Illumina)</option>
-              <option value="rf">RF</option>
-              <option value="ff">FF (for SOLiD)</option>
-            </param>
             <param name="pMaxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" />
             <param name="pForwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)">
               <option value="forward">Align against the forward reference strand</option>
@@ -403,7 +399,7 @@
       <!--
       Bowtie command:
       bowtie-build -f test-data/chr_m.fasta chrM_base
-      bowtie -n 2 -e 70 -l 28 -X 250 +fr +pairtries 100 +maxbts 800 -k 1 +best -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out4.sam
+      bowtie -X 1000 +fr -n 2 -e 70 -l 28 +pairtries 100 +maxbts 800 -k 1 +best -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out4.sam
       -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes.
       chrM_base is the index files' location/base name. 
       -->
@@ -413,6 +409,8 @@
       <param name="sPaired" value="paired" />
       <param name="pInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" />
       <param name="pInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" />
+      <param name="pMaxInsert" value="1000" />
+      <param name="pMateOrient" value="fr" />
       <param name="pSettingsType" value="full" />
       <param name="pSkip" value="0" />
       <param name="pAlignLimit" value="-1" />
@@ -424,8 +422,6 @@
       <param name="pRounding" value="round" />
       <param name="pMaqSoapAlign" value="-1" />
       <param name="pMinInsert" value="0" />
-      <param name="pMaxInsert" value="250" />
-      <param name="pMateOrient" value="fr" />
       <param name="pMaxAlignAttempt" value="100" />
       <param name="pForwardAlign" value="forward" />
       <param name="pReverseAlign" value="reverse" />
@@ -441,7 +437,6 @@
       <param name="suppressHeader" value="true" />
       <output name="output" ftype="sam" file="bowtie_out4.sam" />
     </test>
-<!--  Comment out test 3 because they are failing for an unknown reason  -->
     <test>
       <!--
       Bowtie command:
@@ -478,7 +473,7 @@
       <!--
       Bowtie command:
       bowtie-build +offrate 5 +ftabchars 10 +little -f test-data/chr_m.fasta chrM_base
-      bowtie -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out8.sam
+      bowtie -X 1000 +fr -p 4 -S +sam-nohead -q chrM_base -1 test-data/bowtie_in5.fastqsanger -2 test-data/bowtie_in6.fastqsanger > test-data/bowtie_out8.sam
       -p is the number of threads, hardcoded above. You need to replace the + with 2 dashes.
       chrM_base is the index files' location/base name. 
       -->
@@ -497,6 +492,8 @@
       <param name="sPaired" value="paired" />
       <param name="pInput1" ftype="fastqsanger" value="bowtie_in5.fastqsanger" />
       <param name="pInput2" ftype="fastqsanger" value="bowtie_in6.fastqsanger" />
+      <param name="pMaxInsert" value="1000" />
+      <param name="pMateOrient" value="fr" />
       <param name="pSettingsType" value="preSet" />
       <param name="suppressHeader" value="true" />
       <output name="output" ftype="sam" file="bowtie_out8.sam" />

    

Greg Von Kuster

tags

participants (1)