Hello,
The first input file is not in BED format (specifically, BED12). This would be necessary in order to produce a GFF file with the proper attributes in the feature, frame, and group fields.
The tool BED-to-GFF describes these formats. BED12 files are available from the UCSC table browser and certain other sources. These should not be confused with BED6 files, which are the most common BED format in Galaxy.
Best wishes for your project,
Jen Galaxy team
On 3/7/12 12:15 AM, Robin Mjelle wrote:
Dear Galaxy
I have a problem converting Interval to GFF.
I used the tool BED-to-GFF http://main.g2.bx.psu.edu/tool_runner?tool_id=bed2gff1 converter. My Interval file contains 18 coulmns:
*chr1 33308998 33309020 + cel-let-7-5p 0 chr1 33308999 255 22M * 0 0 AGAGGAAGAAGGAAGAAAAGAA UGAGGUAGUAGGUUGUAUAGUU XA:i:0 MD:Z:22 NM:i:0*
However my GFF output only contains 9, and it has removed the feature "*cel-let-7-5p":*
chr1 bed2gff region_0 33308999 33309020 0 + . region_0;
Instead of region_0 I want the gene name, in this case the miRNA name. How do I do this?
Best Robin
The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at: