
Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the "Cut" tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed Take care, Jen Galaxy team On 11/18/13 12:56 PM, Seung Hee Cho wrote:
Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this?
For example,
*AATGATACGGC_GACCACCG _*_AACACTGCGTTTGCTGGCTTTG_ATG From this sequence, I want to remove *AATGATACGGC_GACCACCG,_* *_so I can get _ "*_AACACTGCGTTTGCTGGCTTTG_ATG" only.
If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much!
Best, *Seung Hee *
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
To search Galaxy mailing lists use the unified search at:
-- Jennifer Hillman-Jackson http://galaxyproject.org