18 Nov
2013
18 Nov
'13
8:56 p.m.
Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG
From this sequence, I want to remove *AATGATACGGCGACCACCG,* *so I can get "**AACACTGCGTTTGCTGGCTTTG*ATG" only.
If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee *