
Linda: Suppose you want to fetch sequences of homologous promoters for all Drosophila genes. Here is an outline of how to do this: 1. Download coordinates of flybase genes from Drosophila melanogaster dm2 genome build (see attached images 1 and 2). 2. Use "Operate on Genomic Intervals -> Get Flanks" to convert coordinates of genes into coordinates of putative promoters by taking 500 bp upstream of each gene (see attached images 3). 3. Use "Fetch alignments -> Stitch MAF blocks" to retrieve homologous sequences for several species (see attached image 4). You will get alignments in FASTA format corresponding to your promoters. They will look like this:
dm2.chr2L(+):825463-825963 CAAAGAGCGTCTCTCCGTCATCTCTATTCACGGCGTAGACCGTGAACCCGTAGCCGG droYak2 CAAAAAGCGTCTCTCCGTCATCTCTTTTTACGGCGTATGCGGTGAATCCGTACCCGG dp4 CAAAGAGCGTCTCGCCGTCGGAGCGCTGGACAGCGTAGGCGGTGAAGCCATAACCAG
Let us know you have problems. Thanks, anton galaxy team On Dec 23, 2009, at 12:23 AM, Linda Barnum wrote:
Hello,
Is there a way to fetch the promoter regions for homologous genes from different species. E.g. say I'd like to fetch the promoter region for a drosophila gene CG13222 from drosophila as well as its CG13222 homologues in other flies from UCSC genome browser?
Thanks, Lin _______________________________________________ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user
Anton Nekrutenko http://nekrut.bx.psu.edu http://galaxyproject.org